RchiOBHm_Chr5g0015641

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
10853679 .. 10855007
1329 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ29606

Sequence Viewer

Length: 219 bp
ATGATAGGAGACAAAAATGGAGAGCCCAAACAGGCTATGGCTATAAAGAAGGTTTTACAATGCAGATTCAAAGAAGTGAGCTCTCTATCCAGACTAAACACTAATGGTAATGAGATTCCACATTCAAATGCAAGCATTCAAGAGTATGTCCCTAGCTGGAAAGCAAATTTGATGGAGAAGCACAAGAGAAAGCCATCAAGGAATTGTTTGAGAAGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

72

Amino Acids

8.22

Weight (kDa)

10.02

Isoelectric Point (pI)

46.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021440)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0015641
rosa_samantha Rh4AG309800 Rh4BG075800 Rh4BG317000 Rh7BG361600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 166
AgsI TTSAA 3 cut(s) 70, 126, 140
AluBI AGCT 2 cut(s) 81, 156
AluI AGCT 2 cut(s) 81, 156
Alw21I GWGCWC 1 cut(s) 83
Alw26I GTCTC 1 cut(s) 3
ApoI RAATTY 1 cut(s) 166
BanII GRGCYC 2 cut(s) 27, 83
Bbv12I GWGCWC 1 cut(s) 83
BccI CCATC 2 cut(s) 166, 202
BcoDI GTCTC 1 cut(s) 3
BfaI CTAG 1 cut(s) 153
BsiHKAI GWGCWC 1 cut(s) 83
BslFI GGGAC 1 cut(s) 134
BsmAI GTCTC 1 cut(s) 3
BsmFI GGGAC 1 cut(s) 134
BsmI GAATGC 1 cut(s) 135
Bsp1286I GDGCHC 2 cut(s) 27, 83
BstC8I GCNNGC 1 cut(s) 133
BstMAI GTCTC 1 cut(s) 3
Cac8I GCNNGC 1 cut(s) 133
CviJI RGCY 6 cut(s) 25, 35, 41, 81, 156, 193
CviKI_1 RGCY 6 cut(s) 25, 35, 41, 81, 156, 193
Ecl136II GAGCTC 1 cut(s) 81
Eco24I GRGCYC 2 cut(s) 27, 83
Eco53kI GAGCTC 1 cut(s) 81
EcoICRI GAGCTC 1 cut(s) 81
EcoT38I GRGCYC 2 cut(s) 27, 83
FaiI YATR 3 cut(s) 38, 44, 147
FaqI GGGAC 1 cut(s) 134
FriOI GRGCYC 2 cut(s) 27, 83
FspBI CTAG 1 cut(s) 153
HinfI GANTC 2 cut(s) 66, 115
Hpy188III TCNNGA 2 cut(s) 90, 140
HpyAV CCTTC 1 cut(s) 43
HpyCH4V TGCA 2 cut(s) 63, 131
LpnPI CCDG 3 cut(s) 17, 103, 142
MaeI CTAG 1 cut(s) 153
MhlI GDGCHC 2 cut(s) 27, 83
MluCI AATT 2 cut(s) 166, 202
MseI TTAA 1 cut(s) 217
MslI CAYNNNNRTG 1 cut(s) 126
Mva1269I GAATGC 1 cut(s) 135
PctI GAATGC 1 cut(s) 135
PfeI GAWTC 2 cut(s) 66, 115
Psp124BI GAGCTC 1 cut(s) 83
RseI CAYNNNNRTG 1 cut(s) 126
SacI GAGCTC 1 cut(s) 83
SaqAI TTAA 1 cut(s) 217
SduI GDGCHC 2 cut(s) 27, 83
SetI ASST 3 cut(s) 54, 83, 158
SgeI CNNG 8 cut(s) 44, 102, 144, 152, 165, 169, 196, 210
SmiMI CAYNNNNRTG 1 cut(s) 126
Sse9I AATT 2 cut(s) 166, 202
SspMI CTAG 1 cut(s) 153
SstI GAGCTC 1 cut(s) 83
TasI AATT 2 cut(s) 166, 202
TfiI GAWTC 2 cut(s) 66, 115
Tru1I TTAA 1 cut(s) 217
Tru9I TTAA 1 cut(s) 217
XapI RAATTY 1 cut(s) 166
XcmI CCANNNNNNNNNTGG 1 cut(s) 34
XspI CTAG 1 cut(s) 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.