Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0021312

Physical Location & Seq

Genomic Coordinates Forward (+)

17701824 .. 17702374

Gene Structure 551 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ30349

Sequence Viewer

CDS Protein Promoter (2k)

Length: 240 bp

ATGAAATATAGAGAACGCGTTCTTGGTTTGATACTTGTATCCCCATTATGCAAAGAACCGTCTTGGACTGAATGGTTTTATAATAAGGTGATATCAAATATGCTATATTTCTATGGCATGTGTGGTTTGTTAACGGAGTGTTTGCTTCAGCATTACTTCAGTAAGAAGGTTCGTGGTAGTGGTGAAGTTCCAAAGTCAGATATAGTTCAAGCATGCAGAAAATTGTTGGAAGAGAGGTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Ndr

Protein Analysis

79

Amino Acids

9.32

Weight (kDa)

8.98

Isoelectric Point (pI)

55.34

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Ndr	PF03096	1 - 78	3.2e-22	Ndr family

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021312)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0342811 RchiOBHm_Chr3g0451871 RchiOBHm_Chr5g0023631
rosa_samantha	Rh5CG181300 Rh5DG167700

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	81
AccII	CGCG	1 cut(s)	18
AcuI	CTGAAG	2 cut(s)	131, 142
AflIII	ACRYGT	1 cut(s)	16
AgsI	TTSAA	1 cut(s)	209
AjuI	GAANNNNNNNTTGG	1 cut(s)	38
Asp700I	GAANNNNTTC	1 cut(s)	18
AsuHPI	GGTGA	2 cut(s)	100, 194
BciVI	GTATCC	1 cut(s)	49
BfuI	GTATCC	1 cut(s)	49
Bsh1236I	CGCG	1 cut(s)	18
BspFNI	CGCG	1 cut(s)	18
Bst4CI	ACNGT	1 cut(s)	60
Bst6I	CTCTTC	1 cut(s)	225
BstC8I	GCNNGC	1 cut(s)	214
BstFNI	CGCG	1 cut(s)	18
BstNSI	RCATGY	2 cut(s)	121, 216
BstUI	CGCG	1 cut(s)	18
BsuI	GTATCC	1 cut(s)	49
Cac8I	GCNNGC	1 cut(s)	214
CviAII	CATG	2 cut(s)	118, 213
Eam1104I	CTCTTC	1 cut(s)	225
EarI	CTCTTC	1 cut(s)	225
Eco32I	GATATC	1 cut(s)	93
Eco57I	CTGAAG	2 cut(s)	131, 142
EcoRV	GATATC	1 cut(s)	93
FaeI	CATG	2 cut(s)	121, 216
FaiI	YATR	9 cut(s)	9, 49, 81, 101, 106, 114, 119, 203, 214
FatI	CATG	2 cut(s)	117, 212
Hin1II	CATG	2 cut(s)	121, 216
HincII	GTYRAC	1 cut(s)	132
HindII	GTYRAC	1 cut(s)	132
HpaI	GTTAAC	1 cut(s)	132
HphI	GGTGA	2 cut(s)	100, 194
Hpy166II	GTNNAC	1 cut(s)	132
Hpy188I	TCNGA	1 cut(s)	199
Hpy8I	GTNNAC	1 cut(s)	132
HpyAV	CCTTC	1 cut(s)	160
HpyCH4III	ACNGT	1 cut(s)	60
HpyCH4V	TGCA	2 cut(s)	51, 216
Hsp92II	CATG	2 cut(s)	121, 216
KspAI	GTTAAC	1 cut(s)	132
MluCI	AATT	1 cut(s)	221
MluI	ACGCGT	1 cut(s)	16
MmeI	TCCRAC	1 cut(s)	207
MnlI	CCTC	1 cut(s)	228
MroXI	GAANNNNTTC	1 cut(s)	18
MseI	TTAA	1 cut(s)	131
MvnI	CGCG	1 cut(s)	18
NlaIII	CATG	2 cut(s)	121, 216
NspI	RCATGY	2 cut(s)	121, 216
PaeI	GCATGC	1 cut(s)	216
PdmI	GAANNNNTTC	1 cut(s)	18
PsiI	TTATAA	1 cut(s)	81
SaqAI	TTAA	1 cut(s)	131
SetI	ASST	3 cut(s)	90, 171, 239
SgeI	CNNG	8 cut(s)	29, 35, 47, 75, 130, 185, 221, 225
SphI	GCATGC	1 cut(s)	216
Sse9I	AATT	1 cut(s)	221
TaaI	ACNGT	1 cut(s)	60
TasI	AATT	1 cut(s)	221
Tru1I	TTAA	1 cut(s)	131
Tru9I	TTAA	1 cut(s)	131
TspDTI	ATGAA	1 cut(s)	17
TspGWI	ACGGA	1 cut(s)	149
XceI	RCATGY	2 cut(s)	121, 216
XmnI	GAANNNNTTC	1 cut(s)	18

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.