RchiOBHm_Chr5g0024961

G-type lectin S-receptor-like serine threonine-protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0025013
Physical Location & Seq
Forward (+)
19000763 .. 19001041
279 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ30465

Sequence Viewer

Length: 279 bp
ATGGTTCTGTGGCAAAGTTTTGATTATCCAGGTGATGTACTTCTGCCAGGCATGAAACTAGGGGTTGACCATAGTAGTGGCCACATTTGGTCACTTTCGTCACGGTTAACTGAAAAAAGTGCAATGCCAGGAGCTTTCACTCTTGATTGGGATCCTGATAGACTTGAAATAAAAATTAGGCTACGAGGGGTAGTTAATTGGAGTAGTGGATTCTTCAGAGATGGAAGTTTTGAGTTTCTTAAGCAGAAGAGGTACAATTTTAGCATTGTTTCAAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
B_lectin DUF3403 PAN_2 Pkinase_Tyr

Protein Analysis

92

Amino Acids

10.57

Weight (kDa)

8.11

Isoelectric Point (pI)

39.02

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
B_lectin PF01453 2 - 35 7.2e-09 D-mannose binding lectin
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025013)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0024961
rosa_laevigata RLG00000032825
rosa_roxburghii Rroxscaffold_1G00054500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 146, 159
AcoI YGGCCR 1 cut(s) 79
AcuI CTGAAG 1 cut(s) 199
AfaI GTAC 2 cut(s) 39, 254
AflII CTTAAG 1 cut(s) 239
AgsI TTSAA 2 cut(s) 167, 273
AjnI CCWGG 3 cut(s) 28, 46, 127
AluBI AGCT 1 cut(s) 134
AluI AGCT 1 cut(s) 134
AlwI GGATC 2 cut(s) 146, 159
AoxI GGCC 1 cut(s) 79
AsuHPI GGTGA 1 cut(s) 44
BalI TGGCCA 1 cut(s) 81
BamHI GGATCC 1 cut(s) 151
BccI CCATC 1 cut(s) 215
BciT130I CCWGG 3 cut(s) 30, 48, 129
BfaI CTAG 1 cut(s) 59
BfrI CTTAAG 1 cut(s) 239
Bme1390I CCNGG 3 cut(s) 30, 48, 129
BmiI GGNNCC 1 cut(s) 153
BmrFI CCNGG 3 cut(s) 30, 48, 129
BsaBI GATNNNNATC 1 cut(s) 150
Bse3DI GCAATG 1 cut(s) 129
Bse8I GATNNNNATC 1 cut(s) 150
BseBI CCWGG 3 cut(s) 30, 48, 129
BseJI GATNNNNATC 1 cut(s) 150
BseMI GCAATG 1 cut(s) 129
BshFI GGCC 1 cut(s) 81
BsnI GGCC 1 cut(s) 81
Bsp143I GATC 1 cut(s) 151
BspANI GGCC 1 cut(s) 81
BspLI GGNNCC 1 cut(s) 153
BspPI GGATC 2 cut(s) 146, 159
BspTI CTTAAG 1 cut(s) 239
BsrDI GCAATG 1 cut(s) 129
BssMI GATC 1 cut(s) 151
Bst2UI CCWGG 3 cut(s) 30, 48, 129
Bst4CI ACNGT 1 cut(s) 105
Bst6I CTCTTC 1 cut(s) 242
BstAFI CTTAAG 1 cut(s) 239
BstKTI GATC 1 cut(s) 154
BstMBI GATC 1 cut(s) 151
BstNI CCWGG 3 cut(s) 30, 48, 129
BstSCI CCNGG 3 cut(s) 28, 46, 127
BstX2I RGATCY 1 cut(s) 151
BstXI CCANNNNNNTGG 1 cut(s) 77
BstYI RGATCY 1 cut(s) 151
BsuRI GGCC 1 cut(s) 81
Csp6I GTAC 2 cut(s) 38, 253
CviAII CATG 1 cut(s) 52
CviJI RGCY 3 cut(s) 81, 134, 181
CviKI_1 RGCY 3 cut(s) 81, 134, 181
CviQI GTAC 2 cut(s) 38, 253
DpnI GATC 1 cut(s) 153
DpnII GATC 1 cut(s) 151
EaeI YGGCCR 1 cut(s) 79
Eam1104I CTCTTC 1 cut(s) 242
EarI CTCTTC 1 cut(s) 242
Eco57I CTGAAG 1 cut(s) 199
EcoRII CCWGG 3 cut(s) 28, 46, 127
FaeI CATG 1 cut(s) 55
FaiI YATR 2 cut(s) 53, 72
FatI CATG 1 cut(s) 51
FspBI CTAG 1 cut(s) 59
HaeIII GGCC 1 cut(s) 81
Hin1II CATG 1 cut(s) 55
HincII GTYRAC 2 cut(s) 67, 108
HindII GTYRAC 2 cut(s) 67, 108
HinfI GANTC 1 cut(s) 210
HpaI GTTAAC 1 cut(s) 108
HphI GGTGA 1 cut(s) 44
Hpy166II GTNNAC 2 cut(s) 67, 108
Hpy188I TCNGA 1 cut(s) 218
Hpy188III TCNNGA 2 cut(s) 143, 155
Hpy8I GTNNAC 2 cut(s) 67, 108
HpyCH4III ACNGT 1 cut(s) 105
HpyCH4V TGCA 1 cut(s) 122
Hsp92II CATG 1 cut(s) 55
KspAI GTTAAC 1 cut(s) 108
Kzo9I GATC 1 cut(s) 151
LmnI GCTCC 1 cut(s) 131
LpnPI CCDG 7 cut(s) 15, 33, 42, 60, 114, 141, 168
MaeI CTAG 1 cut(s) 59
MaeIII GTNAC 2 cut(s) 90, 99
MalI GATC 1 cut(s) 153
MboI GATC 1 cut(s) 151
MboII GAAGA 2 cut(s) 205, 259
MflI RGATCY 1 cut(s) 151
MlsI TGGCCA 1 cut(s) 81
MluCI AATT 4 cut(s) 174, 196, 256, 274
MluNI TGGCCA 1 cut(s) 81
MnlI CCTC 2 cut(s) 179, 243
Mox20I TGGCCA 1 cut(s) 81
MscI TGGCCA 1 cut(s) 81
MseI TTAA 3 cut(s) 107, 195, 240
MslI CAYNNNNRTG 1 cut(s) 75
Msp20I TGGCCA 1 cut(s) 81
MspCI CTTAAG 1 cut(s) 239
MspR9I CCNGG 3 cut(s) 30, 48, 129
MvaI CCWGG 3 cut(s) 30, 48, 129
NdeII GATC 1 cut(s) 151
NlaIII CATG 1 cut(s) 55
NlaIV GGNNCC 1 cut(s) 153
NmuCI GTSAC 2 cut(s) 90, 99
PfeI GAWTC 1 cut(s) 210
Psp6I CCWGG 3 cut(s) 28, 46, 127
PspGI CCWGG 3 cut(s) 28, 46, 127
PspN4I GGNNCC 1 cut(s) 153
PsuI RGATCY 1 cut(s) 151
RsaI GTAC 2 cut(s) 39, 254
RsaNI GTAC 2 cut(s) 38, 253
RseI CAYNNNNRTG 1 cut(s) 75
SaqAI TTAA 3 cut(s) 107, 195, 240
Sau3AI GATC 1 cut(s) 151
ScrFI CCNGG 3 cut(s) 30, 48, 129
SetI ASST 3 cut(s) 34, 136, 254
SmiMI CAYNNNNRTG 1 cut(s) 75
SmlI CTYRAG 1 cut(s) 239
SmoI CTYRAG 1 cut(s) 239
Sse9I AATT 4 cut(s) 174, 196, 256, 274
SspMI CTAG 1 cut(s) 59
StyD4I CCNGG 3 cut(s) 28, 46, 127
TaaI ACNGT 1 cut(s) 105
TasI AATT 4 cut(s) 174, 196, 256, 274
TatI WGTACW 1 cut(s) 37
TfiI GAWTC 1 cut(s) 210
Tru1I TTAA 3 cut(s) 107, 195, 240
Tru9I TTAA 3 cut(s) 107, 195, 240
TseFI GTSAC 2 cut(s) 90, 99
Tsp45I GTSAC 2 cut(s) 90, 99
TspDTI ATGAA 1 cut(s) 68
Vha464I CTTAAG 1 cut(s) 239
XspI CTAG 1 cut(s) 59
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.