RLG00000032825

G-type lectin S-receptor-like serine threonine-protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr7
OG0025013
Physical Location & Seq
Forward (+)
19468370 .. 19471021
2652 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000032825

Sequence Viewer

Length: 663 bp
ATGGTTCTGTGGCAATGTTTTGATTATCCAGGTGATGTACTTCTGCCAGGCATGAAACTAGGGGTTGACCGTAGTAGTGGCCACATTTGGTCAATTTCGTCACGGTTAACTGAAAAAAGTGCAAGGCCAGGAGCTTTCACTCTTGATTGGGATCCTGATAGACTTGAAATAAAAATTAGGCTACGAGGGGGATCAATGCTGACAGGTCAAGAAATAGCTGTAAAGACGCTTTCAAGTGGTTCGGTGCAAGGAGAAGTAGAGTTCAAGAATGATCTGATACTCATATCCGAACTCCAACTTATTAATCTTGTCCAGCTTTTTGGAAATTGCATTCATGGTGAAGAAAGGATATTGGCATGGGAGTTATGGCAAGAAGGTGCAGGACTAGAATTGATGGACGCAACTCTAAGTGATTCGTGTGTCGAAAATCAATTTTTAAGATGCATCCAGGTTGGTCTGCTATGCGTCAAAAAAGATGCAGAGCATCGGCCAACTGTGTCGGATGCTATATCTATGCTGACAAATGAAAGCTTGCCTTTACGCATACCAACAAGACCAGCATCTTTTCCAGTAAGGAATTCGGTTGGAGTAAATATAGGAGGAAATGAATCTGAAAAGATAATAGAAAATGGCATGTCCAACTTCCTTATTGTAGGACGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
B_lectin DUF3403 PAN_2 Pkinase_Tyr

Protein Analysis

221

Amino Acids

24.32

Weight (kDa)

5.06

Isoelectric Point (pI)

39.62

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
B_lectin PF01453 2 - 35 4.5e-07 D-mannose binding lectin
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025013)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0024961
rosa_laevigata RLG00000032825
rosa_roxburghii Rroxscaffold_1G00054500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 146, 159, 199
AcoI YGGCCR 2 cut(s) 79, 488
AcsI RAATTY 1 cut(s) 577
AfaI GTAC 1 cut(s) 39
AgsI TTSAA 3 cut(s) 167, 234, 265
AjnI CCWGG 4 cut(s) 28, 46, 127, 447
AluBI AGCT 4 cut(s) 134, 218, 316, 531
AluI AGCT 4 cut(s) 134, 218, 316, 531
AlwI GGATC 3 cut(s) 146, 159, 199
AoxI GGCC 3 cut(s) 79, 125, 488
ApoI RAATTY 1 cut(s) 577
AseI ATTAAT 1 cut(s) 303
AsuHPI GGTGA 2 cut(s) 44, 350
BalI TGGCCA 1 cut(s) 81
BamHI GGATCC 1 cut(s) 151
BccI CCATC 1 cut(s) 388
BciT130I CCWGG 4 cut(s) 30, 48, 129, 449
BfaI CTAG 2 cut(s) 59, 386
Bme1390I CCNGG 4 cut(s) 30, 48, 129, 449
BmiI GGNNCC 1 cut(s) 153
BmrFI CCNGG 4 cut(s) 30, 48, 129, 449
BmsI GCATC 6 cut(s) 431, 453, 466, 493, 493, 569
BsaBI GATNNNNATC 1 cut(s) 150
Bse1I ACTGG 1 cut(s) 569
Bse3DI GCAATG 1 cut(s) 20
Bse8I GATNNNNATC 1 cut(s) 150
BseBI CCWGG 4 cut(s) 30, 48, 129, 449
BseGI GGATG 2 cut(s) 444, 508
BseJI GATNNNNATC 1 cut(s) 150
BseMI GCAATG 1 cut(s) 20
BseNI ACTGG 1 cut(s) 569
BsgI GTGCAG 1 cut(s) 399
BshFI GGCC 3 cut(s) 81, 127, 490
BsmI GAATGC 1 cut(s) 330
BsnI GGCC 3 cut(s) 81, 127, 490
Bsp143I GATC 3 cut(s) 151, 191, 271
BspANI GGCC 3 cut(s) 81, 127, 490
BspLI GGNNCC 1 cut(s) 153
BspPI GGATC 3 cut(s) 146, 159, 199
BsrDI GCAATG 1 cut(s) 20
BsrI ACTGG 1 cut(s) 569
BssMI GATC 3 cut(s) 151, 191, 271
Bst2UI CCWGG 4 cut(s) 30, 48, 129, 449
Bst4CI ACNGT 3 cut(s) 71, 105, 496
BstC8I GCNNGC 1 cut(s) 533
BstDEI CTNAG 1 cut(s) 407
BstF5I GGATG 2 cut(s) 444, 508
BstKTI GATC 3 cut(s) 154, 194, 274
BstMBI GATC 3 cut(s) 151, 191, 271
BstNI CCWGG 4 cut(s) 30, 48, 129, 449
BstNSI RCATGY 1 cut(s) 637
BstSCI CCNGG 4 cut(s) 28, 46, 127, 447
BstX2I RGATCY 1 cut(s) 151
BstXI CCANNNNNNTGG 1 cut(s) 320
BstYI RGATCY 1 cut(s) 151
BsuRI GGCC 3 cut(s) 81, 127, 490
BtsCI GGATG 2 cut(s) 444, 508
Cac8I GCNNGC 1 cut(s) 533
CseI GACGC 3 cut(s) 235, 407, 454
Csp6I GTAC 1 cut(s) 38
CviAII CATG 4 cut(s) 52, 335, 357, 634
CviJI RGCY 8 cut(s) 81, 127, 134, 181, 218, 316, 490, 531
CviKI_1 RGCY 8 cut(s) 81, 127, 134, 181, 218, 316, 490, 531
CviQI GTAC 1 cut(s) 38
DdeI CTNAG 1 cut(s) 407
DpnI GATC 3 cut(s) 153, 193, 273
DpnII GATC 3 cut(s) 151, 191, 271
EaeI YGGCCR 2 cut(s) 79, 488
EcoRI GAATTC 1 cut(s) 577
EcoRII CCWGG 4 cut(s) 28, 46, 127, 447
EcoT22I ATGCAT 1 cut(s) 446
FaeI CATG 4 cut(s) 55, 338, 360, 637
FalI AAGNNNNNCTT 2 cut(s) 520, 552
FatI CATG 4 cut(s) 51, 334, 356, 633
FokI GGATG 2 cut(s) 431, 515
FspBI CTAG 2 cut(s) 59, 386
HaeIII GGCC 3 cut(s) 81, 127, 490
HgaI GACGC 3 cut(s) 235, 407, 454
Hin1II CATG 4 cut(s) 55, 338, 360, 637
HincII GTYRAC 2 cut(s) 67, 108
HindII GTYRAC 2 cut(s) 67, 108
HindIII AAGCTT 1 cut(s) 529
HinfI GANTC 2 cut(s) 413, 608
HpaI GTTAAC 1 cut(s) 108
HphI GGTGA 2 cut(s) 44, 350
Hpy166II GTNNAC 2 cut(s) 67, 108
Hpy188I TCNGA 4 cut(s) 276, 289, 502, 613
Hpy188III TCNNGA 4 cut(s) 143, 155, 209, 265
Hpy8I GTNNAC 2 cut(s) 67, 108
HpyAV CCTTC 1 cut(s) 368
HpyCH4III ACNGT 3 cut(s) 71, 105, 496
HpyCH4V TGCA 6 cut(s) 122, 247, 330, 380, 444, 479
HpyF3I CTNAG 1 cut(s) 407
Hsp92II CATG 4 cut(s) 55, 338, 360, 637
KspAI GTTAAC 1 cut(s) 108
Kzo9I GATC 3 cut(s) 151, 191, 271
LmnI GCTCC 1 cut(s) 131
LweI GCATC 6 cut(s) 431, 453, 466, 493, 493, 569
MaeI CTAG 2 cut(s) 59, 386
MaeIII GTNAC 1 cut(s) 99
MalI GATC 3 cut(s) 153, 193, 273
MboI GATC 3 cut(s) 151, 191, 271
MboII GAAGA 1 cut(s) 353
MflI RGATCY 1 cut(s) 151
MlsI TGGCCA 1 cut(s) 81
MluCI AATT 6 cut(s) 93, 174, 325, 389, 431, 577
MluNI TGGCCA 1 cut(s) 81
MmeI TCCRAC 4 cut(s) 319, 480, 565, 663
MnlI CCTC 2 cut(s) 179, 593
Mox20I TGGCCA 1 cut(s) 81
Mph1103I ATGCAT 1 cut(s) 446
MscI TGGCCA 1 cut(s) 81
MseI TTAA 3 cut(s) 107, 303, 437
Msp20I TGGCCA 1 cut(s) 81
MspR9I CCNGG 4 cut(s) 30, 48, 129, 449
Mva1269I GAATGC 1 cut(s) 330
MvaI CCWGG 4 cut(s) 30, 48, 129, 449
NdeII GATC 3 cut(s) 151, 191, 271
NlaIII CATG 4 cut(s) 55, 338, 360, 637
NlaIV GGNNCC 1 cut(s) 153
NmuCI GTSAC 1 cut(s) 99
NsiI ATGCAT 1 cut(s) 446
NspI RCATGY 1 cut(s) 637
PctI GAATGC 1 cut(s) 330
PfeI GAWTC 2 cut(s) 413, 608
PshBI ATTAAT 1 cut(s) 303
Psp6I CCWGG 4 cut(s) 28, 46, 127, 447
PspGI CCWGG 4 cut(s) 28, 46, 127, 447
PspN4I GGNNCC 1 cut(s) 153
PsuI RGATCY 1 cut(s) 151
RsaI GTAC 1 cut(s) 39
RsaNI GTAC 1 cut(s) 38
SaqAI TTAA 3 cut(s) 107, 303, 437
Sau3AI GATC 3 cut(s) 151, 191, 271
ScrFI CCNGG 4 cut(s) 30, 48, 129, 449
SetI ASST 8 cut(s) 34, 136, 208, 220, 318, 379, 453, 533
SfaNI GCATC 6 cut(s) 431, 453, 466, 493, 493, 569
Sse9I AATT 6 cut(s) 93, 174, 325, 389, 431, 577
SspMI CTAG 2 cut(s) 59, 386
StyD4I CCNGG 4 cut(s) 28, 46, 127, 447
TaaI ACNGT 3 cut(s) 71, 105, 496
TaqI TCGA 1 cut(s) 423
TasI AATT 6 cut(s) 93, 174, 325, 389, 431, 577
TatI WGTACW 1 cut(s) 37
TfiI GAWTC 2 cut(s) 413, 608
Tru1I TTAA 3 cut(s) 107, 303, 437
Tru9I TTAA 3 cut(s) 107, 303, 437
TseFI GTSAC 1 cut(s) 99
Tsp45I GTSAC 1 cut(s) 99
TspDTI ATGAA 4 cut(s) 68, 323, 540, 621
VspI ATTAAT 1 cut(s) 303
XapI RAATTY 1 cut(s) 577
XceI RCATGY 1 cut(s) 637
XspI CTAG 2 cut(s) 59, 386
Zsp2I ATGCAT 1 cut(s) 446
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.