RchiOBHm_Chr5g0042041

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
36919819 .. 36925111
5293 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ32046

Sequence Viewer

Length: 153 bp
ATGAGACGAAACAAAAAGAGAGAGAGACAAGAGAACAGGCAAGAACGAAAAGAAGGAGAAGAGAGAGACGGGAAGCTTTTGCTTAGATCGTACTTTTTACGTTTTGAACAGCTCCAGTTTTTAACAAGAAGATCGGCTACTTCGTCTATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

50

Amino Acids

6.29

Weight (kDa)

11.14

Isoelectric Point (pI)

99.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021278)

Species Orthologous Gene IDs
pyrus_communis pycom11g07750
rosa_chinensis RchiOBHm_Chr5g0042041
rosa_laevigata RLG00000010213
rosa_samantha Rh5BG288300 Rh5DG297500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 92
AgsI TTSAA 1 cut(s) 107
AluBI AGCT 2 cut(s) 76, 112
AluI AGCT 2 cut(s) 76, 112
Alw26I GTCTC 2 cut(s) 19, 60
BarI GAAGNNNNNNTAC 2 cut(s) 121, 153
BcoDI GTCTC 2 cut(s) 19, 60
BpmI CTGGAG 1 cut(s) 98
Bse1I ACTGG 1 cut(s) 115
BseNI ACTGG 1 cut(s) 115
BsmAI GTCTC 2 cut(s) 19, 60
BsmBI CGTCTC 1 cut(s) 60
Bsp143I GATC 2 cut(s) 86, 131
BsrI ACTGG 1 cut(s) 115
BssMI GATC 2 cut(s) 86, 131
Bst6I CTCTTC 1 cut(s) 54
BstDEI CTNAG 1 cut(s) 83
BstKTI GATC 2 cut(s) 89, 134
BstMAI GTCTC 2 cut(s) 19, 60
BstMBI GATC 2 cut(s) 86, 131
Csp6I GTAC 1 cut(s) 91
CviJI RGCY 3 cut(s) 76, 112, 137
CviKI_1 RGCY 3 cut(s) 76, 112, 137
CviQI GTAC 1 cut(s) 91
DdeI CTNAG 1 cut(s) 83
DpnI GATC 2 cut(s) 88, 133
DpnII GATC 2 cut(s) 86, 131
Eam1104I CTCTTC 1 cut(s) 54
EarI CTCTTC 1 cut(s) 54
Esp3I CGTCTC 1 cut(s) 60
FaiI YATR 1 cut(s) 149
FspEI CC 6 cut(s) 22, 39, 54, 55, 119, 128
GsuI CTGGAG 1 cut(s) 98
HindIII AAGCTT 1 cut(s) 74
HpyAV CCTTC 1 cut(s) 47
HpyCH4IV ACGT 1 cut(s) 100
HpyF3I CTNAG 1 cut(s) 83
HpySE526I ACGT 1 cut(s) 100
Kzo9I GATC 2 cut(s) 86, 131
LmnI GCTCC 1 cut(s) 117
LpnPI CCDG 2 cut(s) 22, 128
MaeII ACGT 1 cut(s) 100
MalI GATC 2 cut(s) 88, 133
MboI GATC 2 cut(s) 86, 131
MboII GAAGA 2 cut(s) 71, 141
MseI TTAA 1 cut(s) 122
NdeII GATC 2 cut(s) 86, 131
PcsI WCGNNNNNNNCGW 1 cut(s) 140
RsaI GTAC 1 cut(s) 92
RsaNI GTAC 1 cut(s) 91
SaqAI TTAA 1 cut(s) 122
Sau3AI GATC 2 cut(s) 86, 131
SetI ASST 3 cut(s) 78, 103, 114
SgeI CNNG 6 cut(s) 41, 49, 53, 82, 127, 138
TaiI ACGT 1 cut(s) 103
Tru1I TTAA 1 cut(s) 122
Tru9I TTAA 1 cut(s) 122
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.