RchiOBHm_Chr5g0071731

source UniProtKB

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0024992
Physical Location & Seq
Forward (+)
77532437 .. 77532917
481 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ34676

Sequence Viewer

Length: 423 bp
ATGAGCTTCTATGGGGTTATTACTGAAATATGGGAGCTTGACTATGATCATTTTAGGGTTCCTATCTTTAAGTGTGATTGGGTAGAGAGTCAGAAGGGTGTTAGAGTAGATGATCTTGGGTTCACTTTGGTGAATTTGAATAGGAAAGGTCATCTAAAAGATACTTTTGTCTTGGGAAAATGTGTGAAGCAAATATTTTATGTTGCTGACCCTATAGATCATAGGTGGTCAGTCGTCTTGAGACTCCCAAAAAAAGATTACAACGATTCTGTTCAGTTTGATGAGCTTGGGGACATCATTATTTCCCACCCTCCCATCGTAACTTCACTGCCATCTTTCCAGTCACTTGATAACTTGACCGATGAGGAACCAATGGGTTACATGCGTGTAGGGGACGATGATATATTAGTTGATGAAGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4216 DUF4218 Transpos_assoc Transposase_21

Protein Analysis

140

Amino Acids

16.25

Weight (kDa)

4.58

Isoelectric Point (pI)

42.88

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF4216 PF13952 11 - 79 3.8e-18 Domain of unknown function (DUF4216)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0024992)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0071731
rosa_multiflora Rmu_co8262241.1_g000001 Rmu_sc0000239.1_g000087

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 133
AgsI TTSAA 1 cut(s) 139
AleI CACNNNNGTG 1 cut(s) 128
AluBI AGCT 3 cut(s) 6, 37, 286
AluI AGCT 3 cut(s) 6, 37, 286
Alw26I GTCTC 1 cut(s) 235
ApoI RAATTY 1 cut(s) 133
AsuHPI GGTGA 1 cut(s) 142
BaeI ACNNNNGTAYC 2 cut(s) 153, 186
BccI CCATC 2 cut(s) 323, 340
BclI TGATCA 1 cut(s) 46
BcoDI GTCTC 1 cut(s) 235
BfmI CTRYAG 1 cut(s) 213
BmiI GGNNCC 2 cut(s) 60, 369
BpuEI CTTGAG 1 cut(s) 259
Bse1I ACTGG 1 cut(s) 340
BseNI ACTGG 1 cut(s) 340
BslFI GGGAC 2 cut(s) 305, 407
BsmAI GTCTC 1 cut(s) 235
BsmFI GGGAC 2 cut(s) 305, 407
Bsp143I GATC 3 cut(s) 46, 112, 217
BspLI GGNNCC 2 cut(s) 60, 369
BsrI ACTGG 1 cut(s) 340
BssMI GATC 3 cut(s) 46, 112, 217
BstKTI GATC 3 cut(s) 49, 115, 220
BstMAI GTCTC 1 cut(s) 235
BstMBI GATC 3 cut(s) 46, 112, 217
BstNSI RCATGY 1 cut(s) 385
BstSFI CTRYAG 1 cut(s) 213
BtsI GCAGTG 1 cut(s) 326
BtsIMutI CAGTG 1 cut(s) 326
CviAII CATG 1 cut(s) 382
CviJI RGCY 3 cut(s) 6, 37, 286
CviKI_1 RGCY 3 cut(s) 6, 37, 286
DpnI GATC 3 cut(s) 48, 114, 219
DpnII GATC 3 cut(s) 46, 112, 217
FaeI CATG 1 cut(s) 385
FaiI YATR 8 cut(s) 12, 31, 45, 201, 215, 222, 383, 404
FaqI GGGAC 2 cut(s) 305, 407
FatI CATG 1 cut(s) 381
FbaI TGATCA 1 cut(s) 46
Hin1II CATG 1 cut(s) 385
HinfI GANTC 3 cut(s) 88, 243, 266
HphI GGTGA 1 cut(s) 142
Hpy166II GTNNAC 1 cut(s) 123
Hpy188I TCNGA 1 cut(s) 93
Hpy188III TCNNGA 1 cut(s) 238
Hpy8I GTNNAC 1 cut(s) 123
HpyAV CCTTC 1 cut(s) 88
Hsp92II CATG 1 cut(s) 385
Ksp22I TGATCA 1 cut(s) 46
Kzo9I GATC 3 cut(s) 46, 112, 217
LmnI GCTCC 1 cut(s) 34
LpnPI CCDG 1 cut(s) 353
MaeIII GTNAC 3 cut(s) 319, 342, 377
MalI GATC 3 cut(s) 48, 114, 219
MboI GATC 3 cut(s) 46, 112, 217
MluCI AATT 1 cut(s) 133
MlyI GAGTC 2 cut(s) 97, 237
MnlI CCTC 2 cut(s) 321, 358
MseI TTAA 1 cut(s) 69
MslI CAYNNNNRTG 1 cut(s) 128
NdeII GATC 3 cut(s) 46, 112, 217
NlaIII CATG 1 cut(s) 385
NlaIV GGNNCC 2 cut(s) 60, 369
NmuCI GTSAC 1 cut(s) 342
NspI RCATGY 1 cut(s) 385
OliI CACNNNNGTG 1 cut(s) 128
PfeI GAWTC 1 cut(s) 266
PleI GAGTC 2 cut(s) 96, 237
PpsI GAGTC 2 cut(s) 96, 237
PspN4I GGNNCC 2 cut(s) 60, 369
RseI CAYNNNNRTG 1 cut(s) 128
SaqAI TTAA 1 cut(s) 69
Sau3AI GATC 3 cut(s) 46, 112, 217
SchI GAGTC 2 cut(s) 97, 237
SetI ASST 5 cut(s) 8, 39, 151, 227, 288
SfcI CTRYAG 1 cut(s) 213
SmiMI CAYNNNNRTG 1 cut(s) 128
SmlI CTYRAG 1 cut(s) 238
SmoI CTYRAG 1 cut(s) 238
Sse9I AATT 1 cut(s) 133
SspI AATATT 1 cut(s) 195
TaqII GACCGA 1 cut(s) 374
TasI AATT 1 cut(s) 133
TfiI GAWTC 1 cut(s) 266
Tru1I TTAA 1 cut(s) 69
Tru9I TTAA 1 cut(s) 69
TscAI CASTG 1 cut(s) 333
TseFI GTSAC 1 cut(s) 342
Tsp45I GTSAC 1 cut(s) 342
TspRI CASTG 1 cut(s) 333
XapI RAATTY 1 cut(s) 133
XceI RCATGY 1 cut(s) 385
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.