Rmu_co8262241.1_g000001

source UniProtKB

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8262241.1
Physical Location & Seq
Forward (+)
1 .. 334
334 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8262241.1_g000001.1.cds

Sequence Viewer

Length: 334 bp
gtgtgattgggttgagagttcaaagggtgtcaaagtggacgatcttggtttcaccttagtgaatttgaataggagaggccatgcaaatgacatattttctttggctacatctgtctatcaaattttttatgtgcaagatcctgcagatcctaggtggtcagtcgttttaagagtccctcatagggattacaatgacttggctaatgatgatgagcttggggacacacaaactgatcaccagccctttaatgatagaatgccatctgttgaaagtggggagggagagataggttacattagggcagacaatgagactattttggttaatgaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

110

Amino Acids

12.48

Weight (kDa)

4.37

Isoelectric Point (pI)

37.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024992)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0071731
rosa_multiflora Rmu_co8262241.1_g000001 Rmu_sc0000239.1_g000087

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 132, 141
AcsI RAATTY 2 cut(s) 62, 121
AfiI CCNNNNNNNGG 1 cut(s) 182
AgsI TTSAA 3 cut(s) 22, 68, 270
AleI CACNNNNGTG 1 cut(s) 57
AluBI AGCT 1 cut(s) 215
AluI AGCT 1 cut(s) 215
Alw26I GTCTC 1 cut(s) 306
AlwI GGATC 2 cut(s) 132, 141
AoxI GGCC 1 cut(s) 77
ApoI RAATTY 2 cut(s) 62, 121
AspA2I CCTAGG 1 cut(s) 150
AsuHPI GGTGA 2 cut(s) 44, 228
AvrII CCTAGG 1 cut(s) 150
BccI CCATC 1 cut(s) 269
BclI TGATCA 1 cut(s) 233
BcoDI GTCTC 1 cut(s) 306
BfaI CTAG 1 cut(s) 151
BfmI CTRYAG 1 cut(s) 142
BlnI CCTAGG 1 cut(s) 150
BsaJI CCNNGG 1 cut(s) 150
Bsc4I CCNNNNNNNGG 1 cut(s) 182
BseDI CCNNGG 1 cut(s) 150
BseLI CCNNNNNNNGG 1 cut(s) 182
BshFI GGCC 1 cut(s) 79
BslFI GGGAC 2 cut(s) 159, 234
BslI CCNNNNNNNGG 1 cut(s) 182
BsmAI GTCTC 1 cut(s) 306
BsmFI GGGAC 2 cut(s) 159, 234
BsmI GAATGC 1 cut(s) 262
BsnI GGCC 1 cut(s) 79
Bsp143I GATC 4 cut(s) 41, 137, 146, 233
BspANI GGCC 1 cut(s) 79
BspMAI CTGCAG 1 cut(s) 146
BspPI GGATC 2 cut(s) 132, 141
BssECI CCNNGG 1 cut(s) 150
BssMI GATC 4 cut(s) 41, 137, 146, 233
BssT1I CCWWGG 1 cut(s) 150
BstDEI CTNAG 1 cut(s) 56
BstKTI GATC 4 cut(s) 44, 140, 149, 236
BstMAI GTCTC 1 cut(s) 306
BstMBI GATC 4 cut(s) 41, 137, 146, 233
BstSFI CTRYAG 1 cut(s) 142
BstX2I RGATCY 2 cut(s) 137, 146
BstYI RGATCY 2 cut(s) 137, 146
BsuRI GGCC 1 cut(s) 79
CviAII CATG 1 cut(s) 81
CviJI RGCY 5 cut(s) 79, 105, 201, 215, 242
CviKI_1 RGCY 5 cut(s) 79, 105, 201, 215, 242
DdeI CTNAG 1 cut(s) 56
DpnI GATC 4 cut(s) 43, 139, 148, 235
DpnII GATC 4 cut(s) 41, 137, 146, 233
Eco130I CCWWGG 1 cut(s) 150
EcoT14I CCWWGG 1 cut(s) 150
ErhI CCWWGG 1 cut(s) 150
FaeI CATG 1 cut(s) 84
FaiI YATR 4 cut(s) 82, 93, 130, 181
FaqI GGGAC 2 cut(s) 159, 234
FatI CATG 1 cut(s) 80
FbaI TGATCA 1 cut(s) 233
FspBI CTAG 1 cut(s) 151
HaeIII GGCC 1 cut(s) 79
Hin1II CATG 1 cut(s) 84
HinfI GANTC 1 cut(s) 172
HphI GGTGA 2 cut(s) 44, 228
Hpy166II GTNNAC 1 cut(s) 38
Hpy8I GTNNAC 1 cut(s) 38
HpyCH4V TGCA 3 cut(s) 84, 134, 144
HpyF3I CTNAG 1 cut(s) 56
Hsp92II CATG 1 cut(s) 84
Ksp22I TGATCA 1 cut(s) 233
Kzo9I GATC 4 cut(s) 41, 137, 146, 233
LpnPI CCDG 2 cut(s) 154, 252
MaeI CTAG 1 cut(s) 151
MaeIII GTNAC 1 cut(s) 291
MalI GATC 4 cut(s) 43, 139, 148, 235
MboI GATC 4 cut(s) 41, 137, 146, 233
MflI RGATCY 2 cut(s) 137, 146
MluCI AATT 2 cut(s) 62, 121
MlyI GAGTC 1 cut(s) 181
MnlI CCTC 3 cut(s) 69, 187, 272
MseI TTAA 3 cut(s) 168, 247, 325
MslI CAYNNNNRTG 2 cut(s) 57, 85
Mva1269I GAATGC 1 cut(s) 262
NdeII GATC 4 cut(s) 41, 137, 146, 233
NlaIII CATG 1 cut(s) 84
OliI CACNNNNGTG 1 cut(s) 57
PctI GAATGC 1 cut(s) 262
PleI GAGTC 1 cut(s) 180
PpsI GAGTC 1 cut(s) 180
PstI CTGCAG 1 cut(s) 146
PsuI RGATCY 2 cut(s) 137, 146
RseI CAYNNNNRTG 2 cut(s) 57, 85
SaqAI TTAA 3 cut(s) 168, 247, 325
Sau3AI GATC 4 cut(s) 41, 137, 146, 233
SchI GAGTC 1 cut(s) 181
SetI ASST 4 cut(s) 57, 156, 217, 293
SfcI CTRYAG 1 cut(s) 142
SgeI CNNG 8 cut(s) 57, 93, 147, 153, 163, 209, 228, 251
SmiMI CAYNNNNRTG 2 cut(s) 57, 85
Sse9I AATT 2 cut(s) 62, 121
SspMI CTAG 1 cut(s) 151
StyI CCWWGG 1 cut(s) 150
TasI AATT 2 cut(s) 62, 121
Tru1I TTAA 3 cut(s) 168, 247, 325
Tru9I TTAA 3 cut(s) 168, 247, 325
XapI RAATTY 2 cut(s) 62, 121
XmaJI CCTAGG 1 cut(s) 150
XspI CTAG 1 cut(s) 151
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.