Rmu_sc0000239.1_g000087

Domain of unknown function (DUF4216)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000239.1
Physical Location & Seq
Forward (+)
508418 .. 508867
450 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000239.1_g000087.1.cds

Sequence Viewer

Length: 450 bp
atggttgttgctagtgctagggacagaaaacctgtagatgacgatatggtcttctatggggtgatagatgaaatttgggagctagattatgctaagtttaggctgcccctctttaagtgtgattgggttgagagttcaaagggtgtcaaggtggatgaccttggtttcactttagtgaatttgaataggagaggccatccaaatgacatattggctttggctacgtctgtctatcaaaatttttatgtccaagatccggtagatcctaggtggtcagttgttctaagagtcccacaaagggattacaatgacttggctcatgatgatgagcttggggacactataattgatcaacagccctttactgatagaatgccatctattgagagtggagatggagaaataggatacattagagcagacaatgagactattttggctaatgaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

149

Amino Acids

17.08

Weight (kDa)

4.36

Isoelectric Point (pI)

40.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024992)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0071731
rosa_multiflora Rmu_co8262241.1_g000001 Rmu_sc0000239.1_g000087

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 47
AclWI GGATC 2 cut(s) 248, 257
AcsI RAATTY 3 cut(s) 72, 178, 238
AfiI CCNNNNNNNGG 2 cut(s) 256, 298
AgsI TTSAA 2 cut(s) 138, 184
AleI CACNNNNGTG 1 cut(s) 173
AluBI AGCT 2 cut(s) 82, 331
AluI AGCT 2 cut(s) 82, 331
Alw26I GTCTC 1 cut(s) 422
AlwI GGATC 2 cut(s) 248, 257
AoxI GGCC 1 cut(s) 193
ApeKI GCWGC 1 cut(s) 103
ApoI RAATTY 3 cut(s) 72, 178, 238
AspA2I CCTAGG 1 cut(s) 266
AsuHPI GGTGA 1 cut(s) 73
AvrII CCTAGG 1 cut(s) 266
BbsI GAAGAC 1 cut(s) 43
BbvI GCAGC 1 cut(s) 90
BccI CCATC 3 cut(s) 204, 385, 389
BciVI GTATCC 1 cut(s) 401
BclI TGATCA 1 cut(s) 349
BcoDI GTCTC 1 cut(s) 422
BfaI CTAG 4 cut(s) 12, 18, 83, 267
BfmI CTRYAG 1 cut(s) 33
BfuI GTATCC 1 cut(s) 401
BisI GCNGC 1 cut(s) 104
BlnI CCTAGG 1 cut(s) 266
BlsI GCNGC 1 cut(s) 105
BpiI GAAGAC 1 cut(s) 43
BsaJI CCNNGG 2 cut(s) 160, 266
BsaWI WCCGGW 1 cut(s) 256
Bsc4I CCNNNNNNNGG 2 cut(s) 256, 298
BseDI CCNNGG 2 cut(s) 160, 266
BseGI GGATG 2 cut(s) 160, 196
BseLI CCNNNNNNNGG 2 cut(s) 256, 298
BseXI GCAGC 1 cut(s) 90
BshFI GGCC 1 cut(s) 195
BsiSI CCGG 1 cut(s) 257
BslFI GGGAC 3 cut(s) 35, 275, 350
BslI CCNNNNNNNGG 2 cut(s) 256, 298
BsmAI GTCTC 1 cut(s) 422
BsmFI GGGAC 3 cut(s) 35, 275, 350
BsmI GAATGC 1 cut(s) 378
BsnI GGCC 1 cut(s) 195
Bsp143I GATC 3 cut(s) 253, 262, 349
BspANI GGCC 1 cut(s) 195
BspHI TCATGA 1 cut(s) 319
BspPI GGATC 2 cut(s) 248, 257
BssECI CCNNGG 2 cut(s) 160, 266
BssMI GATC 3 cut(s) 253, 262, 349
BssT1I CCWWGG 2 cut(s) 160, 266
BstDEI CTNAG 2 cut(s) 93, 284
BstF5I GGATG 2 cut(s) 160, 196
BstKTI GATC 3 cut(s) 256, 265, 352
BstMAI GTCTC 1 cut(s) 422
BstMBI GATC 3 cut(s) 253, 262, 349
BstSFI CTRYAG 1 cut(s) 33
BstV1I GCAGC 1 cut(s) 90
BstV2I GAAGAC 1 cut(s) 43
BstX2I RGATCY 2 cut(s) 253, 262
BstYI RGATCY 2 cut(s) 253, 262
BsuI GTATCC 1 cut(s) 401
BsuRI GGCC 1 cut(s) 195
BtsCI GGATG 2 cut(s) 160, 196
CciI TCATGA 1 cut(s) 319
CviAII CATG 1 cut(s) 320
CviJI RGCY 9 cut(s) 82, 103, 195, 215, 221, 317, 331, 358, 440
CviKI_1 RGCY 9 cut(s) 82, 103, 195, 215, 221, 317, 331, 358, 440
DdeI CTNAG 2 cut(s) 93, 284
DpnI GATC 3 cut(s) 255, 264, 351
DpnII GATC 3 cut(s) 253, 262, 349
DrdI GACNNNNNNGTC 1 cut(s) 47
DseDI GACNNNNNNGTC 1 cut(s) 47
Eco130I CCWWGG 2 cut(s) 160, 266
EcoT14I CCWWGG 2 cut(s) 160, 266
ErhI CCWWGG 2 cut(s) 160, 266
FaeI CATG 1 cut(s) 323
FaiI YATR 7 cut(s) 47, 57, 90, 209, 246, 321, 344
FaqI GGGAC 3 cut(s) 35, 275, 350
FatI CATG 1 cut(s) 319
FbaI TGATCA 1 cut(s) 349
Fnu4HI GCNGC 1 cut(s) 104
FokI GGATG 2 cut(s) 167, 183
Fsp4HI GCNGC 1 cut(s) 104
FspBI CTAG 4 cut(s) 12, 18, 83, 267
GluI GCNGC 1 cut(s) 104
HaeIII GGCC 1 cut(s) 195
HapII CCGG 1 cut(s) 257
Hin1II CATG 1 cut(s) 323
HinfI GANTC 1 cut(s) 288
HpaII CCGG 1 cut(s) 257
HphI GGTGA 1 cut(s) 73
Hpy188III TCNNGA 1 cut(s) 320
HpyCH4IV ACGT 1 cut(s) 224
HpyF3I CTNAG 2 cut(s) 93, 284
HpySE526I ACGT 1 cut(s) 224
Hsp92II CATG 1 cut(s) 323
Ksp22I TGATCA 1 cut(s) 349
Kzo9I GATC 3 cut(s) 253, 262, 349
LmnI GCTCC 1 cut(s) 79
LpnPI CCDG 2 cut(s) 45, 270
Lsp1109I GCAGC 1 cut(s) 90
MaeI CTAG 4 cut(s) 12, 18, 83, 267
MaeII ACGT 1 cut(s) 224
MalI GATC 3 cut(s) 255, 264, 351
MboI GATC 3 cut(s) 253, 262, 349
MboII GAAGA 1 cut(s) 43
MflI RGATCY 2 cut(s) 253, 262
MluCI AATT 4 cut(s) 72, 178, 238, 345
MlyI GAGTC 1 cut(s) 297
MnlI CCTC 2 cut(s) 119, 185
MseI TTAA 1 cut(s) 114
MslI CAYNNNNRTG 3 cut(s) 173, 201, 324
MspI CCGG 1 cut(s) 257
Mva1269I GAATGC 1 cut(s) 378
NdeII GATC 3 cut(s) 253, 262, 349
NlaIII CATG 1 cut(s) 323
OliI CACNNNNGTG 1 cut(s) 173
PagI TCATGA 1 cut(s) 319
PctI GAATGC 1 cut(s) 378
PkrI GCNGC 1 cut(s) 105
PleI GAGTC 1 cut(s) 296
PpsI GAGTC 1 cut(s) 296
PsuI RGATCY 2 cut(s) 253, 262
RseI CAYNNNNRTG 3 cut(s) 173, 201, 324
SaqAI TTAA 1 cut(s) 114
SatI GCNGC 1 cut(s) 104
Sau3AI GATC 3 cut(s) 253, 262, 349
SchI GAGTC 1 cut(s) 297
SetI ASST 7 cut(s) 34, 84, 153, 162, 227, 272, 333
SfcI CTRYAG 1 cut(s) 33
SmiMI CAYNNNNRTG 3 cut(s) 173, 201, 324
Sse9I AATT 4 cut(s) 72, 178, 238, 345
SspMI CTAG 4 cut(s) 12, 18, 83, 267
StyI CCWWGG 2 cut(s) 160, 266
TaiI ACGT 1 cut(s) 227
TasI AATT 4 cut(s) 72, 178, 238, 345
Tru1I TTAA 1 cut(s) 114
Tru9I TTAA 1 cut(s) 114
TseI GCWGC 1 cut(s) 103
TspDTI ATGAA 1 cut(s) 84
XapI RAATTY 3 cut(s) 72, 178, 238
XmaJI CCTAGG 1 cut(s) 266
XspI CTAG 4 cut(s) 12, 18, 83, 267
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.