Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0024316

Physical Location & Seq

Genomic Coordinates Forward (+)

11580451 .. 11580712

Gene Structure 262 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ22999

Sequence Viewer

CDS Protein Promoter (2k)

Length: 162 bp

ATGTTTGTCGGAATCACATTCCCTTTCTTCAGTGGTCTCCTTGGATTTTTCGGAGGATTTGCTTTTGCCCCAACAACATATTTTCTCCCTTGCATAATGTGGCTCGCCATCTACAAACCAAAGAGATTCGGCTTATCCTGGTGGTGCAACTATGTATGTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Aa_trans

Protein Analysis

53

Amino Acids

6.16

Weight (kDa)

9.02

Isoelectric Point (pI)

31.43

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Aa_trans	PF01490	1 - 50	7.7e-11	Transmembrane amino acid transporter protein

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0024316)

Species	Orthologous Gene IDs
malus_domestica	MD09G1016400.v1.1
pyrus_communis	pycom13g09710
rosa_chinensis	RchiOBHm_Chr6g0256391

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcuI	CTGAAG	1 cut(s)	13
AjnI	CCWGG	1 cut(s)	137
Alw26I	GTCTC	1 cut(s)	41
BccI	CCATC	1 cut(s)	116
BciT130I	CCWGG	1 cut(s)	139
BcoDI	GTCTC	1 cut(s)	41
Bme1390I	CCNGG	1 cut(s)	139
BmrFI	CCNGG	1 cut(s)	139
BsaI	GGTCTC	1 cut(s)	41
BsaJI	CCNNGG	1 cut(s)	40
BseBI	CCWGG	1 cut(s)	139
BseDI	CCNNGG	1 cut(s)	40
BsmAI	GTCTC	1 cut(s)	41
Bso31I	GGTCTC	1 cut(s)	41
BspTNI	GGTCTC	1 cut(s)	41
BssECI	CCNNGG	1 cut(s)	40
BssT1I	CCWWGG	1 cut(s)	40
Bst2UI	CCWGG	1 cut(s)	139
BstC8I	GCNNGC	1 cut(s)	105
BstMAI	GTCTC	1 cut(s)	41
BstNI	CCWGG	1 cut(s)	139
BstSCI	CCNGG	1 cut(s)	137
BtsIMutI	CAGTG	1 cut(s)	37
Cac8I	GCNNGC	1 cut(s)	105
CviJI	RGCY	2 cut(s)	103, 132
CviKI_1	RGCY	2 cut(s)	103, 132
Eco130I	CCWWGG	1 cut(s)	40
Eco31I	GGTCTC	1 cut(s)	41
Eco57I	CTGAAG	1 cut(s)	13
EcoRII	CCWGG	1 cut(s)	137
EcoT14I	CCWWGG	1 cut(s)	40
ErhI	CCWWGG	1 cut(s)	40
FaiI	YATR	4 cut(s)	79, 95, 153, 157
HinfI	GANTC	2 cut(s)	12, 126
Hpy188I	TCNGA	2 cut(s)	11, 53
HpyCH4V	TGCA	2 cut(s)	93, 147
LpnPI	CCDG	2 cut(s)	124, 151
MboII	GAAGA	1 cut(s)	19
MnlI	CCTC	1 cut(s)	47
MspR9I	CCNGG	1 cut(s)	139
MvaI	CCWGG	1 cut(s)	139
PfeI	GAWTC	2 cut(s)	12, 126
Psp6I	CCWGG	1 cut(s)	137
PspGI	CCWGG	1 cut(s)	137
ScrFI	CCNGG	1 cut(s)	139
SgeI	CNNG	5 cut(s)	53, 102, 116, 150, 151
StyD4I	CCNGG	1 cut(s)	137
StyI	CCWWGG	1 cut(s)	40
TfiI	GAWTC	2 cut(s)	12, 126
TscAI	CASTG	1 cut(s)	37
TspRI	CASTG	1 cut(s)	37

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.