Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0022798

Physical Location & Seq

Genomic Coordinates Reverse (-)

52209956 .. 52212237

Gene Structure 2282 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ25927

Sequence Viewer

CDS Protein Promoter (2k)

Length: 123 bp

ATGGAAAGTTCTGAAGAGCTGTTCTTCATTGATCTAGCTACTATAAGGAAAGCTACCAATGACTTTTCAGATTCAAACAAGCTTGGACAAGGTGGATTGGTGCTGTGTACAAGGGTTGGCTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004672 GO:0004674 GO:0005575 GO:0005623 GO:0005886 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0006950 GO:0006952 GO:0008150 GO:0008152 GO:0009605 GO:0009607 GO:0009617 GO:0009987 GO:0016020 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019538 GO:0036211 GO:0042742 GO:0043170 GO:0043207 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044464 GO:0050896 GO:0051704 GO:0051707 GO:0071704 GO:0071944 GO:0098542 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF3403 Pkinase_Tyr Stress-antifung

Protein Analysis

40

Amino Acids

4.36

Weight (kDa)

4.59

Isoelectric Point (pI)

44.43

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022798)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr6g0288991
rosa_roxburghii	Rroxscaffold_2G00079010
rosa_samantha	Rh1BG366000 Rh6BG318200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcuI	CTGAAG	1 cut(s)	33
AfaI	GTAC	1 cut(s)	109
AgsI	TTSAA	1 cut(s)	75
AluBI	AGCT	4 cut(s)	19, 38, 53, 82
AluI	AGCT	4 cut(s)	19, 38, 53, 82
BfaI	CTAG	2 cut(s)	35, 121
Bsp1407I	TGTACA	1 cut(s)	107
Bsp143I	GATC	1 cut(s)	31
BspQI	GCTCTTC	1 cut(s)	9
BsrGI	TGTACA	1 cut(s)	107
BssMI	GATC	1 cut(s)	31
Bst6I	CTCTTC	1 cut(s)	9
BstAUI	TGTACA	1 cut(s)	107
BstKTI	GATC	1 cut(s)	34
BstMBI	GATC	1 cut(s)	31
Csp6I	GTAC	1 cut(s)	108
CviJI	RGCY	5 cut(s)	19, 38, 53, 82, 120
CviKI_1	RGCY	5 cut(s)	19, 38, 53, 82, 120
CviQI	GTAC	1 cut(s)	108
DpnI	GATC	1 cut(s)	33
DpnII	GATC	1 cut(s)	31
Eam1104I	CTCTTC	1 cut(s)	9
EarI	CTCTTC	1 cut(s)	9
Eco57I	CTGAAG	1 cut(s)	33
FaiI	YATR	1 cut(s)	44
FspBI	CTAG	2 cut(s)	35, 121
FspEI	CC	9 cut(s)	31, 69, 70, 75, 78, 83, 97, 98, 102
HindIII	AAGCTT	1 cut(s)	80
HinfI	GANTC	1 cut(s)	71
Hpy166II	GTNNAC	1 cut(s)	108
Hpy188I	TCNGA	2 cut(s)	13, 70
Hpy8I	GTNNAC	1 cut(s)	108
Kzo9I	GATC	1 cut(s)	31
LguI	GCTCTTC	1 cut(s)	9
MaeI	CTAG	2 cut(s)	35, 121
MalI	GATC	1 cut(s)	33
MboI	GATC	1 cut(s)	31
MboII	GAAGA	2 cut(s)	16, 26
NdeII	GATC	1 cut(s)	31
PciSI	GCTCTTC	1 cut(s)	9
PfeI	GAWTC	1 cut(s)	71
RsaI	GTAC	1 cut(s)	109
RsaNI	GTAC	1 cut(s)	108
SapI	GCTCTTC	1 cut(s)	9
Sau3AI	GATC	1 cut(s)	31
SetI	ASST	5 cut(s)	21, 40, 55, 84, 94
SgeI	CNNG	4 cut(s)	47, 91, 95, 101
SspMI	CTAG	2 cut(s)	35, 121
TatI	WGTACW	1 cut(s)	107
TfiI	GAWTC	1 cut(s)	71
TspDTI	ATGAA	1 cut(s)	16
XspI	CTAG	2 cut(s)	35, 121

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.