Rh1BG366000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
Physical Location & Seq
Forward (+)
49497627 .. 49501667
4041 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG366000.1

Sequence Viewer

Length: 213 bp
ATGCAAATTTCTGCAATTAATGTTGACTTCATAAGAGGCTGGGATCTGACAATGGCTAACCCTGTATATTGGATTCAGGCAAGTCTTGACACTAGCAGAAAAGAGGATTGGAAAATGTCCAAGATGAAGAAAGAAGCCAGCATGGACTTTTACCTGAATTTTAAACCCCACTGGAGTCACAATCATAGAAGAAGACAAAATGGAAAGTTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

8.52

Weight (kDa)

9.9

Isoelectric Point (pI)

43.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022798)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr6g0288991
rosa_roxburghii Rroxscaffold_2G00079010
rosa_samantha Rh1BG366000 Rh6BG318200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 51
AcsI RAATTY 2 cut(s) 6, 157
AjuI GAANNNNNNNTTGG 2 cut(s) 91, 123
AlwI GGATC 1 cut(s) 51
ApoI RAATTY 2 cut(s) 6, 157
AseI ATTAAT 1 cut(s) 18
BbsI GAAGAC 1 cut(s) 199
BfaI CTAG 1 cut(s) 93
BpiI GAAGAC 1 cut(s) 199
BpmI CTGGAG 1 cut(s) 193
Bse1I ACTGG 1 cut(s) 176
BseNI ACTGG 1 cut(s) 176
BseYI CCCAGC 1 cut(s) 39
Bsp143I GATC 1 cut(s) 43
BspPI GGATC 1 cut(s) 51
BsrI ACTGG 1 cut(s) 176
BssMI GATC 1 cut(s) 43
BstC8I GCNNGC 1 cut(s) 139
BstKTI GATC 1 cut(s) 46
BstMBI GATC 1 cut(s) 43
BstV2I GAAGAC 1 cut(s) 199
BstX2I RGATCY 1 cut(s) 43
BstYI RGATCY 1 cut(s) 43
BtsIMutI CAGTG 1 cut(s) 169
Cac8I GCNNGC 1 cut(s) 139
CviAII CATG 1 cut(s) 142
CviJI RGCY 3 cut(s) 39, 56, 137
CviKI_1 RGCY 3 cut(s) 39, 56, 137
DpnI GATC 1 cut(s) 45
DpnII GATC 1 cut(s) 43
DraI TTTAAA 1 cut(s) 163
FaeI CATG 1 cut(s) 145
FaiI YATR 4 cut(s) 32, 67, 143, 186
FatI CATG 1 cut(s) 141
FspBI CTAG 1 cut(s) 93
GsaI CCCAGC 1 cut(s) 43
GsuI CTGGAG 1 cut(s) 193
Hin1II CATG 1 cut(s) 145
HincII GTYRAC 1 cut(s) 25
HindII GTYRAC 1 cut(s) 25
HinfI GANTC 2 cut(s) 73, 175
Hpy166II GTNNAC 1 cut(s) 25
Hpy188I TCNGA 2 cut(s) 48, 212
Hpy188III TCNNGA 1 cut(s) 86
Hpy8I GTNNAC 1 cut(s) 25
HpyCH4V TGCA 2 cut(s) 4, 14
Hsp92II CATG 1 cut(s) 145
Kzo9I GATC 1 cut(s) 43
LpnPI CCDG 6 cut(s) 25, 62, 75, 151, 157, 167
MaeI CTAG 1 cut(s) 93
MaeIII GTNAC 1 cut(s) 176
MalI GATC 1 cut(s) 45
MboI GATC 1 cut(s) 43
MboII GAAGA 3 cut(s) 139, 201, 204
MflI RGATCY 1 cut(s) 43
MluCI AATT 3 cut(s) 6, 15, 157
MlyI GAGTC 1 cut(s) 184
MnlI CCTC 2 cut(s) 29, 97
MseI TTAA 2 cut(s) 18, 162
NdeII GATC 1 cut(s) 43
NlaIII CATG 1 cut(s) 145
NmuCI GTSAC 1 cut(s) 176
PfeI GAWTC 1 cut(s) 73
PleI GAGTC 1 cut(s) 183
PpsI GAGTC 1 cut(s) 183
PshBI ATTAAT 1 cut(s) 18
PspFI CCCAGC 1 cut(s) 39
PsuI RGATCY 1 cut(s) 43
SaqAI TTAA 2 cut(s) 18, 162
Sau3AI GATC 1 cut(s) 43
SchI GAGTC 1 cut(s) 184
SetI ASST 1 cut(s) 156
Sse9I AATT 3 cut(s) 6, 15, 157
SspMI CTAG 1 cut(s) 93
TasI AATT 3 cut(s) 6, 15, 157
TfiI GAWTC 1 cut(s) 73
Tru1I TTAA 2 cut(s) 18, 162
Tru9I TTAA 2 cut(s) 18, 162
TscAI CASTG 1 cut(s) 176
TseFI GTSAC 1 cut(s) 176
Tsp45I GTSAC 1 cut(s) 176
TspDTI ATGAA 2 cut(s) 19, 140
TspRI CASTG 1 cut(s) 176
VspI ATTAAT 1 cut(s) 18
XapI RAATTY 2 cut(s) 6, 157
XspI CTAG 1 cut(s) 93
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.