Rroxscaffold_2G00079010

Cysteine-rich receptor-like protein kinase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Forward (+)
2114295 .. 2117820
3526 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00079010.1

Sequence Viewer

Length: 168 bp
ATGGAAAGTTCTGAAGAGCTGTTGTTCATTGATCTAGCTACTATAAGGAAAGCTACCAATGACTTTTCAGATTCAAACAAGCTTGGACAAGGTGGATTGGTGCTGTGTACAAGTTGGTTTGCGCTCGGAACTGACACAGGAAAGGTTAAAATGACAAAGGCTATGTAA

Protein Analysis

55

Amino Acids

5.97

Weight (kDa)

5.04

Isoelectric Point (pI)

32.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022798)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr6g0288991
rosa_roxburghii Rroxscaffold_2G00079010
rosa_samantha Rh1BG366000 Rh6BG318200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 33
AfaI GTAC 1 cut(s) 109
AgsI TTSAA 1 cut(s) 75
AluBI AGCT 4 cut(s) 19, 38, 53, 82
AluI AGCT 4 cut(s) 19, 38, 53, 82
AspLEI GCGC 1 cut(s) 124
BfaI CTAG 1 cut(s) 35
Bsp1407I TGTACA 1 cut(s) 107
Bsp143I GATC 1 cut(s) 31
BspQI GCTCTTC 1 cut(s) 9
BsrGI TGTACA 1 cut(s) 107
BssMI GATC 1 cut(s) 31
Bst6I CTCTTC 1 cut(s) 9
BstAUI TGTACA 1 cut(s) 107
BstHHI GCGC 1 cut(s) 124
BstKTI GATC 1 cut(s) 34
BstMBI GATC 1 cut(s) 31
CfoI GCGC 1 cut(s) 124
Csp6I GTAC 1 cut(s) 108
CviJI RGCY 5 cut(s) 19, 38, 53, 82, 161
CviKI_1 RGCY 5 cut(s) 19, 38, 53, 82, 161
CviQI GTAC 1 cut(s) 108
DpnI GATC 1 cut(s) 33
DpnII GATC 1 cut(s) 31
Eam1104I CTCTTC 1 cut(s) 9
EarI CTCTTC 1 cut(s) 9
Eco57I CTGAAG 1 cut(s) 33
FaiI YATR 2 cut(s) 44, 164
FspBI CTAG 1 cut(s) 35
GlaI GCGC 1 cut(s) 123
HhaI GCGC 1 cut(s) 124
Hin6I GCGC 1 cut(s) 122
HinP1I GCGC 1 cut(s) 122
HindIII AAGCTT 1 cut(s) 80
HinfI GANTC 1 cut(s) 71
Hpy166II GTNNAC 1 cut(s) 108
Hpy188I TCNGA 3 cut(s) 13, 70, 128
Hpy8I GTNNAC 1 cut(s) 108
HspAI GCGC 1 cut(s) 122
Kzo9I GATC 1 cut(s) 31
LguI GCTCTTC 1 cut(s) 9
LpnPI CCDG 1 cut(s) 123
MaeI CTAG 1 cut(s) 35
MalI GATC 1 cut(s) 33
MboI GATC 1 cut(s) 31
MboII GAAGA 1 cut(s) 26
MseI TTAA 1 cut(s) 147
NdeII GATC 1 cut(s) 31
PciSI GCTCTTC 1 cut(s) 9
PfeI GAWTC 1 cut(s) 71
RsaI GTAC 1 cut(s) 109
RsaNI GTAC 1 cut(s) 108
SapI GCTCTTC 1 cut(s) 9
SaqAI TTAA 1 cut(s) 147
Sau3AI GATC 1 cut(s) 31
SetI ASST 6 cut(s) 21, 40, 55, 84, 94, 147
SgeI CNNG 7 cut(s) 47, 91, 95, 101, 123, 137, 150
SspMI CTAG 1 cut(s) 35
TatI WGTACW 1 cut(s) 107
TfiI GAWTC 1 cut(s) 71
Tru1I TTAA 1 cut(s) 147
Tru9I TTAA 1 cut(s) 147
TspDTI ATGAA 1 cut(s) 16
XspI CTAG 1 cut(s) 35
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.