RchiOBHm_Chr6g0295231

LEC14B homolog

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0022714
Physical Location & Seq
Forward (+)
57317614 .. 57318340
727 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ26493

Sequence Viewer

Length: 525 bp
ATGTCTCCCTTGTCCTACATGTACATTTTTGTCACACTAATATTTCAATTCTTGAACAGTCCAAGGATTACAGATCATGACTGGGATTACAGATGGACGGAGTACCCAGCTCATGCAAGAACTTCGAGACATCCCTTGGATCAGTTGTTGGCTACCTATAGAGACCATTCAGTCCTGCACACTTTAATTCGCTGTTACTTTTCTTTAGCATATAGGTCCTGGGAAGTTGGCCTAGTAAAACAGCTAGTTTCCCTTTACCCAGAATCTTATTTGCTAGCTATTGTTTTGGTTATAGGGCATCATTTCATCTCTATGCAATACAATGGACAAAAGTACATCTACACTGGATCTAGTGATCATTTGGTCTATATTTATGATCTGGTAGTTGACATTTCTCACTATCAAGATGTGTCTTTTGCATGTAATTTCTGTGAAATAGCTAATGGAATGAGAAGTGGTAACTGTCATCTTTTAGTATTCGTCTGCACACTCAGGCACATAAACAATTTGGCTTCTGATCTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
WD40

Protein Analysis

174

Amino Acids

20.38

Weight (kDa)

6.38

Isoelectric Point (pI)

42.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022714)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0399031 RchiOBHm_Chr5g0070511 RchiOBHm_Chr6g0295231
rosa_samantha Rh2DG399300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 170
AclWI GGATC 2 cut(s) 147, 355
AfaI GTAC 3 cut(s) 23, 104, 335
AflIII ACRYGT 1 cut(s) 18
AgsI TTSAA 2 cut(s) 47, 55
AjnI CCWGG 1 cut(s) 218
AluBI AGCT 4 cut(s) 110, 244, 278, 440
AluI AGCT 4 cut(s) 110, 244, 278, 440
Alw26I GTCTC 3 cut(s) 9, 121, 156
AlwI GGATC 2 cut(s) 147, 355
AoxI GGCC 1 cut(s) 229
AspS9I GGNCC 1 cut(s) 216
AsuNHI GCTAGC 1 cut(s) 274
AvaII GGWCC 1 cut(s) 216
BccI CCATC 1 cut(s) 87
BcgI CGANNNNNNTGC 2 cut(s) 105, 139
BciT130I CCWGG 1 cut(s) 220
BclI TGATCA 1 cut(s) 355
BcoDI GTCTC 3 cut(s) 9, 121, 156
BfaI CTAG 4 cut(s) 233, 245, 275, 351
BfmI CTRYAG 1 cut(s) 157
Bme1390I CCNGG 1 cut(s) 220
Bme18I GGWCC 1 cut(s) 216
BmgT120I GGNCC 1 cut(s) 216
BmrFI CCNGG 1 cut(s) 220
BmrI ACTGGG 1 cut(s) 91
BmsI GCATC 1 cut(s) 307
BmtI GCTAGC 1 cut(s) 278
BmuI ACTGGG 1 cut(s) 91
BsaI GGTCTC 1 cut(s) 156
BsaJI CCNNGG 3 cut(s) 62, 135, 219
Bse1I ACTGG 2 cut(s) 86, 349
BseBI CCWGG 1 cut(s) 220
BseDI CCNNGG 3 cut(s) 62, 135, 219
BseGI GGATG 1 cut(s) 130
BseMII CTCAG 1 cut(s) 505
BseNI ACTGG 2 cut(s) 86, 349
BseYI CCCAGC 1 cut(s) 106
BsgI GTGCAG 2 cut(s) 161, 469
BshFI GGCC 1 cut(s) 231
BsmAI GTCTC 3 cut(s) 9, 121, 156
BsnI GGCC 1 cut(s) 231
Bso31I GGTCTC 1 cut(s) 156
Bsp1407I TGTACA 1 cut(s) 21
Bsp143I GATC 6 cut(s) 73, 139, 347, 355, 376, 517
BspANI GGCC 1 cut(s) 231
BspCNI CTCAG 1 cut(s) 504
BspHI TCATGA 1 cut(s) 76
BspOI GCTAGC 1 cut(s) 278
BspPI GGATC 2 cut(s) 147, 355
BspTNI GGTCTC 1 cut(s) 156
BsrGI TGTACA 1 cut(s) 21
BsrI ACTGG 2 cut(s) 86, 349
BssECI CCNNGG 3 cut(s) 62, 135, 219
BssMI GATC 6 cut(s) 73, 139, 347, 355, 376, 517
BssT1I CCWWGG 2 cut(s) 62, 135
Bst2UI CCWGG 1 cut(s) 220
Bst4CI ACNGT 2 cut(s) 59, 464
BstAUI TGTACA 1 cut(s) 21
BstC8I GCNNGC 1 cut(s) 276
BstDEI CTNAG 1 cut(s) 491
BstF5I GGATG 1 cut(s) 130
BstKTI GATC 6 cut(s) 76, 142, 350, 358, 379, 520
BstMAI GTCTC 3 cut(s) 9, 121, 156
BstMBI GATC 6 cut(s) 73, 139, 347, 355, 376, 517
BstNI CCWGG 1 cut(s) 220
BstNSI RCATGY 2 cut(s) 22, 423
BstSCI CCNGG 1 cut(s) 218
BstSFI CTRYAG 1 cut(s) 157
BstX2I RGATCY 1 cut(s) 347
BstYI RGATCY 1 cut(s) 347
BsuRI GGCC 1 cut(s) 231
BtsCI GGATG 1 cut(s) 130
BtsIMutI CAGTG 1 cut(s) 342
Cac8I GCNNGC 1 cut(s) 276
CciI TCATGA 1 cut(s) 76
Cfr13I GGNCC 1 cut(s) 216
Csp6I GTAC 3 cut(s) 22, 103, 334
CviAII CATG 4 cut(s) 19, 77, 113, 420
CviJI RGCY 7 cut(s) 110, 152, 231, 244, 278, 440, 512
CviKI_1 RGCY 7 cut(s) 110, 152, 231, 244, 278, 440, 512
CviQI GTAC 3 cut(s) 22, 103, 334
DdeI CTNAG 1 cut(s) 491
DpnI GATC 6 cut(s) 75, 141, 349, 357, 378, 519
DpnII GATC 6 cut(s) 73, 139, 347, 355, 376, 517
DrdI GACNNNNNNGTC 1 cut(s) 170
DseDI GACNNNNNNGTC 1 cut(s) 170
Eco130I CCWWGG 2 cut(s) 62, 135
Eco31I GGTCTC 1 cut(s) 156
Eco47I GGWCC 1 cut(s) 216
EcoO109I RGGNCCY 1 cut(s) 216
EcoRII CCWGG 1 cut(s) 218
EcoT14I CCWWGG 2 cut(s) 62, 135
ErhI CCWWGG 2 cut(s) 62, 135
FaeI CATG 4 cut(s) 22, 80, 116, 423
FatI CATG 4 cut(s) 18, 76, 112, 419
FbaI TGATCA 1 cut(s) 355
FokI GGATG 1 cut(s) 117
FspBI CTAG 4 cut(s) 233, 245, 275, 351
GsaI CCCAGC 1 cut(s) 110
HaeIII GGCC 1 cut(s) 231
Hin1II CATG 4 cut(s) 22, 80, 116, 423
HincII GTYRAC 1 cut(s) 388
HindII GTYRAC 1 cut(s) 388
HinfI GANTC 1 cut(s) 263
Hpy166II GTNNAC 1 cut(s) 388
Hpy188I TCNGA 1 cut(s) 517
Hpy188III TCNNGA 4 cut(s) 52, 77, 126, 404
Hpy8I GTNNAC 1 cut(s) 388
HpyCH4III ACNGT 2 cut(s) 59, 464
HpyCH4V TGCA 5 cut(s) 116, 178, 316, 419, 486
HpyF3I CTNAG 1 cut(s) 491
Hsp92II CATG 4 cut(s) 22, 80, 116, 423
Ksp22I TGATCA 1 cut(s) 355
Kzo9I GATC 6 cut(s) 73, 139, 347, 355, 376, 517
LpnPI CCDG 9 cut(s) 67, 120, 188, 205, 232, 273, 330, 365, 478
LweI GCATC 1 cut(s) 307
MaeI CTAG 4 cut(s) 233, 245, 275, 351
MaeIII GTNAC 3 cut(s) 31, 194, 458
MalI GATC 6 cut(s) 75, 141, 349, 357, 378, 519
MboI GATC 6 cut(s) 73, 139, 347, 355, 376, 517
MflI RGATCY 1 cut(s) 347
MluCI AATT 4 cut(s) 47, 186, 424, 505
MseI TTAA 1 cut(s) 185
MslI CAYNNNNRTG 1 cut(s) 311
MspR9I CCNGG 1 cut(s) 220
MvaI CCWGG 1 cut(s) 220
NdeII GATC 6 cut(s) 73, 139, 347, 355, 376, 517
NheI GCTAGC 1 cut(s) 274
NlaIII CATG 4 cut(s) 22, 80, 116, 423
NmuCI GTSAC 1 cut(s) 31
NspI RCATGY 2 cut(s) 22, 423
PagI TCATGA 1 cut(s) 76
PciI ACATGT 1 cut(s) 18
PfeI GAWTC 1 cut(s) 263
PpuMI RGGWCCY 1 cut(s) 216
PscI ACATGT 1 cut(s) 18
Psp5II RGGWCCY 1 cut(s) 216
Psp6I CCWGG 1 cut(s) 218
PspFI CCCAGC 1 cut(s) 106
PspGI CCWGG 1 cut(s) 218
PspPI GGNCC 1 cut(s) 216
PspPPI RGGWCCY 1 cut(s) 216
PsuI RGATCY 1 cut(s) 347
RsaI GTAC 3 cut(s) 23, 104, 335
RsaNI GTAC 3 cut(s) 22, 103, 334
RseI CAYNNNNRTG 1 cut(s) 311
SaqAI TTAA 1 cut(s) 185
Sau3AI GATC 6 cut(s) 73, 139, 347, 355, 376, 517
Sau96I GGNCC 1 cut(s) 216
ScrFI CCNGG 1 cut(s) 220
SetI ASST 6 cut(s) 112, 158, 218, 246, 280, 442
SfaNI GCATC 1 cut(s) 307
SfcI CTRYAG 1 cut(s) 157
SinI GGWCC 1 cut(s) 216
SmiMI CAYNNNNRTG 1 cut(s) 311
Sse9I AATT 4 cut(s) 47, 186, 424, 505
SspI AATATT 1 cut(s) 42
SspMI CTAG 4 cut(s) 233, 245, 275, 351
StyD4I CCNGG 1 cut(s) 218
StyI CCWWGG 2 cut(s) 62, 135
TaaI ACNGT 2 cut(s) 59, 464
TaqI TCGA 1 cut(s) 125
TasI AATT 4 cut(s) 47, 186, 424, 505
TatI WGTACW 2 cut(s) 21, 333
TfiI GAWTC 1 cut(s) 263
Tru1I TTAA 1 cut(s) 185
Tru9I TTAA 1 cut(s) 185
TscAI CASTG 1 cut(s) 349
TseFI GTSAC 1 cut(s) 31
Tsp45I GTSAC 1 cut(s) 31
TspDTI ATGAA 1 cut(s) 295
TspGWI ACGGA 1 cut(s) 113
TspRI CASTG 1 cut(s) 349
VpaK11BI GGWCC 1 cut(s) 216
XceI RCATGY 2 cut(s) 22, 423
XspI CTAG 4 cut(s) 233, 245, 275, 351
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.