RchiOBHm_Chr6g0296381

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Forward (+)
58130537 .. 58130749
213 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ26604

Sequence Viewer

Length: 213 bp
ATGTCTCTCGGCCCCACCACCTCCTTTTCTCTATTCTCTGATTCTTTTTTAATTATACTTCCACGGTTCCATCTCTTCCCTCTTAGCCTCAACTATTCTTCTTCTCTCCTATTCCTCCTCCTCCTCATTCACTTCTTCGTATTCAACTATTCCAGTCTCATCCTAGTCGGAAAAAAACTATTAGCAAGCAGCAGCCATGGTTCTCAAGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

7.83

Weight (kDa)

8.25

Isoelectric Point (pI)

43.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024788)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0313771 RchiOBHm_Chr6g0296381
rosa_samantha Rh6BG157300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 145
Alw26I GTCTC 2 cut(s) 9, 161
AoxI GGCC 1 cut(s) 10
ApeKI GCWGC 2 cut(s) 189, 192
AspS9I GGNCC 1 cut(s) 11
BbvI GCAGC 2 cut(s) 201, 204
BccI CCATC 1 cut(s) 78
BcoDI GTCTC 2 cut(s) 9, 161
BfaI CTAG 1 cut(s) 164
BisI GCNGC 2 cut(s) 190, 193
BlsI GCNGC 2 cut(s) 191, 194
BmgT120I GGNCC 1 cut(s) 11
BmiI GGNNCC 2 cut(s) 13, 68
BpuEI CTTGAG 1 cut(s) 189
BsaJI CCNNGG 2 cut(s) 62, 196
Bse1I ACTGG 1 cut(s) 153
BseDI CCNNGG 2 cut(s) 62, 196
BseGI GGATG 1 cut(s) 159
BseNI ACTGG 1 cut(s) 153
BseRI GAGGAG 3 cut(s) 107, 110, 113
BseXI GCAGC 2 cut(s) 201, 204
BshFI GGCC 1 cut(s) 12
BsmAI GTCTC 2 cut(s) 9, 161
BsnI GGCC 1 cut(s) 12
Bsp19I CCATGG 1 cut(s) 196
BspANI GGCC 1 cut(s) 12
BspLI GGNNCC 2 cut(s) 13, 68
BsrI ACTGG 1 cut(s) 153
BssECI CCNNGG 2 cut(s) 62, 196
BssT1I CCWWGG 1 cut(s) 196
Bst4CI ACNGT 1 cut(s) 66
Bst6I CTCTTC 1 cut(s) 80
BstC8I GCNNGC 1 cut(s) 187
BstDEI CTNAG 1 cut(s) 83
BstDSI CCRYGG 2 cut(s) 62, 196
BstF5I GGATG 1 cut(s) 159
BstMAI GTCTC 2 cut(s) 9, 161
BstV1I GCAGC 2 cut(s) 201, 204
BsuRI GGCC 1 cut(s) 12
BtgI CCRYGG 2 cut(s) 62, 196
BtsCI GGATG 1 cut(s) 159
Cac8I GCNNGC 1 cut(s) 187
Cfr13I GGNCC 1 cut(s) 11
CviAII CATG 1 cut(s) 197
CviJI RGCY 3 cut(s) 12, 87, 195
CviKI_1 RGCY 3 cut(s) 12, 87, 195
DdeI CTNAG 1 cut(s) 83
Eam1104I CTCTTC 1 cut(s) 80
EarI CTCTTC 1 cut(s) 80
Eco130I CCWWGG 1 cut(s) 196
EcoT14I CCWWGG 1 cut(s) 196
ErhI CCWWGG 1 cut(s) 196
FaeI CATG 1 cut(s) 200
FaiI YATR 2 cut(s) 56, 198
FatI CATG 1 cut(s) 196
Fnu4HI GCNGC 2 cut(s) 190, 193
FokI GGATG 1 cut(s) 146
Fsp4HI GCNGC 2 cut(s) 190, 193
FspBI CTAG 1 cut(s) 164
GluI GCNGC 2 cut(s) 190, 193
HaeIII GGCC 1 cut(s) 12
Hin1II CATG 1 cut(s) 200
HinfI GANTC 1 cut(s) 41
Hpy188I TCNGA 2 cut(s) 40, 170
Hpy188III TCNNGA 1 cut(s) 206
HpyCH4III ACNGT 1 cut(s) 66
HpyF3I CTNAG 1 cut(s) 83
Hsp92II CATG 1 cut(s) 200
LpnPI CCDG 1 cut(s) 166
Lsp1109I GCAGC 2 cut(s) 201, 204
MaeI CTAG 1 cut(s) 164
MboII GAAGA 4 cut(s) 67, 90, 93, 127
MluCI AATT 1 cut(s) 51
MmeI TCCRAC 1 cut(s) 148
MnlI CCTC 7 cut(s) 31, 90, 98, 125, 128, 131, 134
MseI TTAA 1 cut(s) 50
NcoI CCATGG 1 cut(s) 196
NlaIII CATG 1 cut(s) 200
NlaIV GGNNCC 2 cut(s) 13, 68
PfeI GAWTC 1 cut(s) 41
PkrI GCNGC 2 cut(s) 191, 194
PspN4I GGNNCC 2 cut(s) 13, 68
PspPI GGNCC 1 cut(s) 11
SaqAI TTAA 1 cut(s) 50
SatI GCNGC 2 cut(s) 190, 193
Sau96I GGNCC 1 cut(s) 11
SetI ASST 1 cut(s) 23
SgeI CNNG 6 cut(s) 20, 75, 165, 176, 198, 209
SmlI CTYRAG 1 cut(s) 204
SmoI CTYRAG 1 cut(s) 204
Sse9I AATT 1 cut(s) 51
SspMI CTAG 1 cut(s) 164
StyI CCWWGG 1 cut(s) 196
TaaI ACNGT 1 cut(s) 66
TasI AATT 1 cut(s) 51
TfiI GAWTC 1 cut(s) 41
Tru1I TTAA 1 cut(s) 50
Tru9I TTAA 1 cut(s) 50
TseI GCWGC 2 cut(s) 189, 192
XspI CTAG 1 cut(s) 164
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.