RchiOBHm_Chr7g0235001

Belongs to the glycosyl hydrolase 1 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0022468
Physical Location & Seq
Forward (+)
59682412 .. 59682979
568 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ21061

Sequence Viewer

Length: 312 bp
ATGGGAAAGTCTGGCATCATATCTGTTTTAGGTCAACGGACACATCGCACATCATCATTAAAGGACTGGCTGAGGGTAAAATATTTGCGTGGACACATTGGGAGTCTGCTCAATGCTTTAAGGAATGGATCAAACACCCGAAGGTATTTTATATGGTCGTTCCTGGATTCGCTTGAGCTGTTGGATGGCTATAAATCGAGCTACGGCCTATACTACGTTGATTTGGACGACCCTGATCTGAAAAGACATCCTAAACTCTCTGCTCATTGGTACTCCCAGTTTTTAAAGAGGCAAAATATCACTGCAGTCTGA

Protein Analysis

103

Amino Acids

12.0

Weight (kDa)

9.99

Isoelectric Point (pI)

35.73

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Glyco_hydro_1 PF00232 15 - 98 3.6e-22 Glycosyl hydrolase family 1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022468)

Species Orthologous Gene IDs
prunus_persica Prupe.6G156300_v2.0.a1
rosa_chinensis RchiOBHm_Chr7g0235001
rosa_rugosa Rorug07G0287000
rosa_samantha Rh7CG463000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 136
AfaI GTAC 1 cut(s) 272
AjnI CCWGG 1 cut(s) 162
AluBI AGCT 2 cut(s) 178, 201
AluI AGCT 2 cut(s) 178, 201
AlwI GGATC 1 cut(s) 136
AoxI GGCC 1 cut(s) 205
BbvCI CCTCAGC 1 cut(s) 71
BccI CCATC 1 cut(s) 179
BceAI ACGGC 1 cut(s) 220
BciT130I CCWGG 1 cut(s) 164
BfmI CTRYAG 1 cut(s) 303
Bme1390I CCNGG 1 cut(s) 164
BmrFI CCNGG 1 cut(s) 164
BmrI ACTGGG 1 cut(s) 271
BmsI GCATC 1 cut(s) 24
BmuI ACTGGG 1 cut(s) 271
Bpu10I CCTNAGC 1 cut(s) 71
BpuEI CTTGAG 1 cut(s) 194
Bse1I ACTGG 2 cut(s) 71, 277
BseBI CCWGG 1 cut(s) 164
BseGI GGATG 2 cut(s) 190, 247
BseMII CTCAG 1 cut(s) 62
BseNI ACTGG 2 cut(s) 71, 277
BshFI GGCC 1 cut(s) 207
BsnI GGCC 1 cut(s) 207
Bsp143I GATC 2 cut(s) 128, 235
BspANI GGCC 1 cut(s) 207
BspCNI CTCAG 1 cut(s) 63
BspMAI CTGCAG 1 cut(s) 307
BspPI GGATC 1 cut(s) 136
BsrI ACTGG 2 cut(s) 71, 277
BssMI GATC 2 cut(s) 128, 235
Bst2UI CCWGG 1 cut(s) 164
BstDEI CTNAG 1 cut(s) 71
BstF5I GGATG 2 cut(s) 190, 247
BstKTI GATC 2 cut(s) 131, 238
BstMBI GATC 2 cut(s) 128, 235
BstNI CCWGG 1 cut(s) 164
BstSCI CCNGG 1 cut(s) 162
BstSFI CTRYAG 1 cut(s) 303
BsuRI GGCC 1 cut(s) 207
BtgZI GCGATG 1 cut(s) 29
BtsCI GGATG 2 cut(s) 190, 247
BtsI GCAGTG 1 cut(s) 300
BtsIMutI CAGTG 1 cut(s) 300
Csp6I GTAC 1 cut(s) 271
CviJI RGCY 5 cut(s) 70, 178, 189, 201, 207
CviKI_1 RGCY 5 cut(s) 70, 178, 189, 201, 207
CviQI GTAC 1 cut(s) 271
DdeI CTNAG 1 cut(s) 71
DpnI GATC 2 cut(s) 130, 237
DpnII GATC 2 cut(s) 128, 235
DraI TTTAAA 1 cut(s) 285
EcoRII CCWGG 1 cut(s) 162
FaiI YATR 5 cut(s) 20, 152, 154, 192, 211
FokI GGATG 2 cut(s) 197, 234
HaeIII GGCC 1 cut(s) 207
HincII GTYRAC 1 cut(s) 35
HindII GTYRAC 1 cut(s) 35
HinfI GANTC 2 cut(s) 103, 167
Hpy166II GTNNAC 2 cut(s) 35, 92
Hpy188I TCNGA 2 cut(s) 240, 311
Hpy8I GTNNAC 2 cut(s) 35, 92
HpyAV CCTTC 1 cut(s) 135
HpyCH4IV ACGT 1 cut(s) 216
HpyCH4V TGCA 1 cut(s) 305
HpyF3I CTNAG 1 cut(s) 71
HpySE526I ACGT 1 cut(s) 216
Kzo9I GATC 2 cut(s) 128, 235
LpnPI CCDG 5 cut(s) 52, 149, 176, 246, 290
LweI GCATC 1 cut(s) 24
MaeII ACGT 1 cut(s) 216
MalI GATC 2 cut(s) 130, 237
MboI GATC 2 cut(s) 128, 235
MlyI GAGTC 1 cut(s) 112
MmeI TCCRAC 1 cut(s) 162
MnlI CCTC 2 cut(s) 66, 282
MseI TTAA 3 cut(s) 59, 119, 284
MspR9I CCNGG 1 cut(s) 164
MvaI CCWGG 1 cut(s) 164
NdeII GATC 2 cut(s) 128, 235
PfeI GAWTC 1 cut(s) 167
PfoI TCCNGGA 1 cut(s) 162
PleI GAGTC 1 cut(s) 111
PpsI GAGTC 1 cut(s) 111
Psp6I CCWGG 1 cut(s) 162
PspGI CCWGG 1 cut(s) 162
PstI CTGCAG 1 cut(s) 307
RsaI GTAC 1 cut(s) 272
RsaNI GTAC 1 cut(s) 271
SaqAI TTAA 3 cut(s) 59, 119, 284
Sau3AI GATC 2 cut(s) 128, 235
SchI GAGTC 1 cut(s) 112
ScrFI CCNGG 1 cut(s) 164
SetI ASST 5 cut(s) 34, 146, 180, 203, 219
SfaNI GCATC 1 cut(s) 24
SfcI CTRYAG 1 cut(s) 303
SmlI CTYRAG 1 cut(s) 173
SmoI CTYRAG 1 cut(s) 173
SspI AATATT 1 cut(s) 83
StyD4I CCNGG 1 cut(s) 162
TaiI ACGT 1 cut(s) 219
TaqI TCGA 1 cut(s) 197
TfiI GAWTC 1 cut(s) 167
Tru1I TTAA 3 cut(s) 59, 119, 284
Tru9I TTAA 3 cut(s) 59, 119, 284
TscAI CASTG 1 cut(s) 307
TspGWI ACGGA 1 cut(s) 52
TspRI CASTG 1 cut(s) 307
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.