Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0022813

Physical Location & Seq

Genomic Coordinates Forward (+)

62239424 .. 62240729

Gene Structure 1306 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ21256

Sequence Viewer

CDS Protein Promoter (2k)

Length: 168 bp

ATGCTCTCTAAGGTGGCTCAGCTGAGAAAGCACATTGACGCAACACTAGGTAGTGGGAACCTAAGAGAATCAGTAAAGCTTCCAACTGGCGAAGATTTAAATGAGTGGCTTGCTGTCAACAGTAAATCTCTTTTTCATCATAATTTGAATTGTCTTTTAATTTGTTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04111 ko04390 ko04391 ko04392 map04111 map04390 map04391 map04392

Pfam Domains

Protein Families

Mob1_phocein

Protein Analysis

55

Amino Acids

6.13

Weight (kDa)

7.86

Isoelectric Point (pI)

34.04

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Mob1_phocein	PF03637	14 - 47	3.1e-08	Mob1/phocein family

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022813)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr7g0237191 RchiOBHm_Chr7g0237201
rosa_rugosa	Rorug04G0017400
rosa_samantha	Rh7DG283800

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	1 cut(s)	148
AluBI	AGCT	2 cut(s)	22, 79
AluI	AGCT	2 cut(s)	22, 79
BfaI	CTAG	1 cut(s)	47
BlpI	GCTNAGC	1 cut(s)	18
BmiI	GGNNCC	1 cut(s)	59
Bpu1102I	GCTNAGC	1 cut(s)	18
Bse1I	ACTGG	1 cut(s)	91
BseMII	CTCAG	2 cut(s)	14, 32
BseNI	ACTGG	1 cut(s)	91
Bsp1720I	GCTNAGC	1 cut(s)	18
BspCNI	CTCAG	2 cut(s)	15, 31
BspLI	GGNNCC	1 cut(s)	59
BsrI	ACTGG	1 cut(s)	91
Bst4CI	ACNGT	1 cut(s)	122
BstC8I	GCNNGC	1 cut(s)	111
BstDEI	CTNAG	4 cut(s)	9, 18, 23, 62
BstMWI	GCNNNNNNNGC	1 cut(s)	28
Cac8I	GCNNGC	1 cut(s)	111
CseI	GACGC	1 cut(s)	47
CviJI	RGCY	4 cut(s)	17, 22, 79, 109
CviKI_1	RGCY	4 cut(s)	17, 22, 79, 109
DdeI	CTNAG	4 cut(s)	9, 18, 23, 62
DraI	TTTAAA	1 cut(s)	99
FaiI	YATR	1 cut(s)	141
FspBI	CTAG	1 cut(s)	47
FspEI	CC	7 cut(s)	33, 39, 40, 72, 74, 91, 96
HgaI	GACGC	1 cut(s)	47
HincII	GTYRAC	1 cut(s)	118
HindII	GTYRAC	1 cut(s)	118
HindIII	AAGCTT	1 cut(s)	77
HinfI	GANTC	1 cut(s)	68
Hpy166II	GTNNAC	1 cut(s)	118
Hpy8I	GTNNAC	1 cut(s)	118
HpyCH4III	ACNGT	1 cut(s)	122
HpyF10VI	GCNNNNNNNGC	1 cut(s)	28
HpyF3I	CTNAG	4 cut(s)	9, 18, 23, 62
LpnPI	CCDG	1 cut(s)	72
MaeI	CTAG	1 cut(s)	47
MboII	GAAGA	1 cut(s)	104
MluCI	AATT	3 cut(s)	142, 148, 159
MmeI	TCCRAC	1 cut(s)	107
MseI	TTAA	2 cut(s)	98, 158
MspA1I	CMGCKG	1 cut(s)	22
MwoI	GCNNNNNNNGC	1 cut(s)	28
NlaIV	GGNNCC	1 cut(s)	59
PfeI	GAWTC	1 cut(s)	68
PspN4I	GGNNCC	1 cut(s)	59
PvuII	CAGCTG	1 cut(s)	22
SaqAI	TTAA	2 cut(s)	98, 158
SetI	ASST	5 cut(s)	15, 24, 52, 63, 81
SgeI	CNNG	3 cut(s)	59, 99, 122
SmiI	ATTTAAAT	1 cut(s)	99
Sse9I	AATT	3 cut(s)	142, 148, 159
SspMI	CTAG	1 cut(s)	47
SwaI	ATTTAAAT	1 cut(s)	99
TaaI	ACNGT	1 cut(s)	122
TasI	AATT	3 cut(s)	142, 148, 159
TfiI	GAWTC	1 cut(s)	68
Tru1I	TTAA	2 cut(s)	98, 158
Tru9I	TTAA	2 cut(s)	98, 158
TspDTI	ATGAA	1 cut(s)	125
XspI	CTAG	1 cut(s)	47

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.