Rmu_co8108530.1_g000001

Protein trichome birefringence-like 36

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8108530.1
OG0022555
Physical Location & Seq
Forward (+)
1 .. 366
366 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8108530.1_g000001.1.cds

Sequence Viewer

Length: 320 bp
ctgtgaagtcatcagcgtttgagctagaggaggatgagtactcatggcttaacgatgaagatgatcaggctaacatggttcagagccaccaaagttcaagaagcaagtgtgaactgtctgccggaaagtgggtttatgatcaatcctaccctctctatgactcgagctgtccatatcttagcactgctgtcgcttgtcagaaaaatggaaggcctgattccgactacgaaaagtggcgctggaagccaaacgactgttccattcctaggtacctaccgacctactctaaaactaacactagtgtaaattttcccttgtga

Protein Analysis

105

Amino Acids

12.18

Weight (kDa)

4.73

Isoelectric Point (pI)

59.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022555)

Species Orthologous Gene IDs
pyrus_communis pycom11g23760
rosa_laevigata RLG00000033191
rosa_multiflora Rmu_co8108530.1_g000001
rosa_roxburghii Rroxscaffold_1G00050230

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 269
AccB1I GGYRCC 1 cut(s) 269
AcsI RAATTY 1 cut(s) 306
AfaI GTAC 2 cut(s) 40, 271
AfiI CCNNNNNNNGG 2 cut(s) 128, 266
AgsI TTSAA 1 cut(s) 98
AhlI ACTAGT 1 cut(s) 298
AjuI GAANNNNNNNTTGG 2 cut(s) 240, 272
AluBI AGCT 2 cut(s) 24, 167
AluI AGCT 2 cut(s) 24, 167
Ama87I CYCGRG 1 cut(s) 162
AoxI GGCC 1 cut(s) 211
ApoI RAATTY 1 cut(s) 306
Asp718I GGTACC 1 cut(s) 269
AspA2I CCTAGG 1 cut(s) 265
AspLEI GCGC 1 cut(s) 239
AvaI CYCGRG 1 cut(s) 162
AvrII CCTAGG 1 cut(s) 265
BanI GGYRCC 1 cut(s) 269
BcgI CGANNNNNNTGC 2 cut(s) 171, 205
BclI TGATCA 2 cut(s) 63, 138
BcuI ACTAGT 1 cut(s) 298
BfaI CTAG 3 cut(s) 25, 266, 299
BfoI RGCGCY 1 cut(s) 240
BlnI CCTAGG 1 cut(s) 265
BmcAI AGTACT 1 cut(s) 40
BmeT110I CYCGRG 1 cut(s) 162
BmiI GGNNCC 1 cut(s) 271
BsaJI CCNNGG 1 cut(s) 265
BsaXI ACNNNNNCTCC 2 cut(s) 22, 52
Bsc4I CCNNNNNNNGG 2 cut(s) 128, 266
BseDI CCNNGG 1 cut(s) 265
BseGI GGATG 1 cut(s) 39
BseLI CCNNNNNNNGG 2 cut(s) 128, 266
BseRI GAGGAG 1 cut(s) 43
BshFI GGCC 1 cut(s) 213
BshNI GGYRCC 1 cut(s) 269
BsiHKCI CYCGRG 1 cut(s) 162
BsiSI CCGG 1 cut(s) 122
BslI CCNNNNNNNGG 2 cut(s) 128, 266
BsnI GGCC 1 cut(s) 213
BsoBI CYCGRG 1 cut(s) 162
Bsp143I GATC 2 cut(s) 63, 138
BspANI GGCC 1 cut(s) 213
BspLI GGNNCC 1 cut(s) 271
BspT107I GGYRCC 1 cut(s) 269
BssECI CCNNGG 1 cut(s) 265
BssMI GATC 2 cut(s) 63, 138
BssT1I CCWWGG 1 cut(s) 265
Bst4CI ACNGT 2 cut(s) 116, 256
BstDEI CTNAG 1 cut(s) 178
BstF5I GGATG 1 cut(s) 39
BstH2I RGCGCY 1 cut(s) 240
BstHHI GCGC 1 cut(s) 239
BstKTI GATC 2 cut(s) 66, 141
BstMBI GATC 2 cut(s) 63, 138
BstMWI GCNNNNNNNGC 1 cut(s) 243
BsuRI GGCC 1 cut(s) 213
BtsCI GGATG 1 cut(s) 39
BtsI GCAGTG 1 cut(s) 182
BtsIMutI CAGTG 1 cut(s) 182
CfoI GCGC 1 cut(s) 239
Csp6I GTAC 2 cut(s) 39, 270
CviAII CATG 2 cut(s) 44, 75
CviJI RGCY 7 cut(s) 24, 48, 70, 86, 167, 213, 246
CviKI_1 RGCY 7 cut(s) 24, 48, 70, 86, 167, 213, 246
CviQI GTAC 2 cut(s) 39, 270
DdeI CTNAG 1 cut(s) 178
DpnI GATC 2 cut(s) 65, 140
DpnII GATC 2 cut(s) 63, 138
Eco130I CCWWGG 1 cut(s) 265
Eco147I AGGCCT 1 cut(s) 213
Eco88I CYCGRG 1 cut(s) 162
EcoT14I CCWWGG 1 cut(s) 265
ErhI CCWWGG 1 cut(s) 265
FaeI CATG 2 cut(s) 47, 78
FaiI YATR 5 cut(s) 45, 76, 137, 158, 174
FatI CATG 2 cut(s) 43, 74
FbaI TGATCA 2 cut(s) 63, 138
FokI GGATG 1 cut(s) 46
FspBI CTAG 3 cut(s) 25, 266, 299
GlaI GCGC 1 cut(s) 238
HaeII RGCGCY 1 cut(s) 240
HaeIII GGCC 1 cut(s) 213
HapII CCGG 1 cut(s) 122
HhaI GCGC 1 cut(s) 239
Hin1II CATG 2 cut(s) 47, 78
Hin6I GCGC 1 cut(s) 237
HinP1I GCGC 1 cut(s) 237
HinfI GANTC 2 cut(s) 160, 217
HpaII CCGG 1 cut(s) 122
Hpy166II GTNNAC 1 cut(s) 112
Hpy188I TCNGA 3 cut(s) 83, 200, 222
Hpy188III TCNNGA 1 cut(s) 98
Hpy8I GTNNAC 1 cut(s) 112
HpyAV CCTTC 1 cut(s) 203
HpyCH4III ACNGT 2 cut(s) 116, 256
HpyF10VI GCNNNNNNNGC 1 cut(s) 243
HpyF3I CTNAG 1 cut(s) 178
Hsp92II CATG 2 cut(s) 47, 78
HspAI GCGC 1 cut(s) 237
KpnI GGTACC 1 cut(s) 273
Ksp22I TGATCA 2 cut(s) 63, 138
Kzo9I GATC 2 cut(s) 63, 138
LpnPI CCDG 4 cut(s) 52, 135, 225, 227
MaeI CTAG 3 cut(s) 25, 266, 299
MalI GATC 2 cut(s) 65, 140
MboI GATC 2 cut(s) 63, 138
MboII GAAGA 1 cut(s) 70
MluCI AATT 1 cut(s) 306
MlyI GAGTC 1 cut(s) 154
MmeI TCCRAC 1 cut(s) 245
MnlI CCTC 3 cut(s) 21, 24, 161
MseI TTAA 1 cut(s) 50
MspI CCGG 1 cut(s) 122
MwoI GCNNNNNNNGC 1 cut(s) 243
NdeII GATC 2 cut(s) 63, 138
NlaIII CATG 2 cut(s) 47, 78
NlaIV GGNNCC 1 cut(s) 271
PaeR7I CTCGAG 1 cut(s) 162
PceI AGGCCT 1 cut(s) 213
PfeI GAWTC 1 cut(s) 217
PleI GAGTC 1 cut(s) 154
PpsI GAGTC 1 cut(s) 154
PspN4I GGNNCC 1 cut(s) 271
PspXI VCTCGAGB 1 cut(s) 162
RsaI GTAC 2 cut(s) 40, 271
RsaNI GTAC 2 cut(s) 39, 270
SaqAI TTAA 1 cut(s) 50
Sau3AI GATC 2 cut(s) 63, 138
ScaI AGTACT 1 cut(s) 40
SchI GAGTC 1 cut(s) 154
SetI ASST 5 cut(s) 26, 169, 271, 275, 283
Sfr274I CTCGAG 1 cut(s) 162
SlaI CTCGAG 1 cut(s) 162
SmlI CTYRAG 1 cut(s) 162
SmoI CTYRAG 1 cut(s) 162
SpeI ACTAGT 1 cut(s) 298
Sse9I AATT 1 cut(s) 306
SseBI AGGCCT 1 cut(s) 213
SspMI CTAG 3 cut(s) 25, 266, 299
StuI AGGCCT 1 cut(s) 213
StyI CCWWGG 1 cut(s) 265
TaaI ACNGT 2 cut(s) 116, 256
TaqI TCGA 1 cut(s) 163
TasI AATT 1 cut(s) 306
TatI WGTACW 1 cut(s) 38
TfiI GAWTC 1 cut(s) 217
Tru1I TTAA 1 cut(s) 50
Tru9I TTAA 1 cut(s) 50
TscAI CASTG 1 cut(s) 189
TspDTI ATGAA 1 cut(s) 71
TspRI CASTG 1 cut(s) 189
XapI RAATTY 1 cut(s) 306
XhoI CTCGAG 1 cut(s) 162
XmaJI CCTAGG 1 cut(s) 265
XspI CTAG 3 cut(s) 25, 266, 299
ZrmI AGTACT 1 cut(s) 40
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.