Rmu_co8117556.1_g000001

Receptor-like protein kinase THESEUS

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8117556.1
Physical Location & Seq
Reverse (-)
2 .. 541
540 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8117556.1_g000001.1.cds

Sequence Viewer

Length: 540 bp
atggcggttccattagagcctggtattgagattcctagtcatgtagcttttgagacagggtataggatcaacatgggaggtccacatataacccccaagaatgacacattgtggaggacatgggaaccagatcaggcttttcttgtcaatgctgcatctgcgagaaatgtcacagccaatccacgctcaatcaaataccctgatggagtgtcggtcgaaattgcaccgaattgggtttatgccacagctcaggaaatggcagatgcaaatgtgttgaatcagaaatttaacatatcatgggcatttaaagttgaatatggcttcagctatcttattaggctgcatttctgtgacattgtaagtgcatctctaaatcatttgcttttcaatgtgtatatcaaccaactatctgctctagactcttttgatatctcaagcaggacaatggcattgtcagcagcttacttcatagactttgtgacaaatgtgtcaatgggatcagaccggatattggttcagattggtcctcccatgctaact

Protein Analysis

180

Amino Acids

20.06

Weight (kDa)

5.22

Isoelectric Point (pI)

26.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014801)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 487
AciI CCGC 1 cut(s) 5
AclWI GGATC 2 cut(s) 74, 505
AcsI RAATTY 1 cut(s) 284
AcuI CTGAAG 1 cut(s) 307
AdeI CACNNNGTG 1 cut(s) 111
AfiI CCNNNNNNNGG 1 cut(s) 511
AgsI TTSAA 3 cut(s) 277, 314, 388
AjnI CCWGG 1 cut(s) 19
AluBI AGCT 4 cut(s) 47, 248, 327, 461
AluI AGCT 4 cut(s) 47, 248, 327, 461
Alw26I GTCTC 1 cut(s) 47
AlwI GGATC 2 cut(s) 74, 505
ApeKI GCWGC 3 cut(s) 152, 340, 458
ApoI RAATTY 1 cut(s) 284
AspS9I GGNCC 2 cut(s) 80, 524
AvaII GGWCC 2 cut(s) 80, 524
BbvI GCAGC 3 cut(s) 139, 327, 470
BccI CCATC 1 cut(s) 197
BciT130I CCWGG 1 cut(s) 21
BcoDI GTCTC 1 cut(s) 47
BfaI CTAG 2 cut(s) 36, 416
BisI GCNGC 3 cut(s) 153, 341, 459
BlsI GCNGC 3 cut(s) 154, 342, 460
Bme1390I CCNGG 1 cut(s) 21
Bme18I GGWCC 2 cut(s) 80, 524
BmgT120I GGNCC 2 cut(s) 80, 524
BmiI GGNNCC 2 cut(s) 9, 126
BmrFI CCNGG 1 cut(s) 21
BmsI GCATC 3 cut(s) 164, 253, 374
Bpu10I CCTNAGC 1 cut(s) 249
BpuEI CTTGAG 1 cut(s) 418
BsaWI WCCGGW 1 cut(s) 504
BsaXI ACNNNNNCTCC 2 cut(s) 198, 228
Bsc4I CCNNNNNNNGG 1 cut(s) 511
BseBI CCWGG 1 cut(s) 21
BseLI CCNNNNNNNGG 1 cut(s) 511
BseMII CTCAG 1 cut(s) 263
BseXI GCAGC 3 cut(s) 139, 327, 470
Bsh1285I CGRYCG 1 cut(s) 216
BsiEI CGRYCG 1 cut(s) 216
BsiSI CCGG 1 cut(s) 505
BslI CCNNNNNNNGG 1 cut(s) 511
BsmAI GTCTC 1 cut(s) 47
Bsp143I GATC 3 cut(s) 66, 130, 497
BspACI CCGC 1 cut(s) 5
BspCNI CTCAG 1 cut(s) 262
BspLI GGNNCC 2 cut(s) 9, 126
BspPI GGATC 2 cut(s) 74, 505
BssMI GATC 3 cut(s) 66, 130, 497
Bst2UI CCWGG 1 cut(s) 21
BstDEI CTNAG 1 cut(s) 249
BstKTI GATC 3 cut(s) 69, 133, 500
BstMAI GTCTC 1 cut(s) 47
BstMBI GATC 3 cut(s) 66, 130, 497
BstMCI CGRYCG 1 cut(s) 216
BstMWI GCNNNNNNNGC 2 cut(s) 158, 455
BstNI CCWGG 1 cut(s) 21
BstSCI CCNGG 1 cut(s) 19
BstV1I GCAGC 3 cut(s) 139, 327, 470
Cfr13I GGNCC 2 cut(s) 80, 524
CviAII CATG 5 cut(s) 41, 73, 120, 297, 532
CviJI RGCY 9 cut(s) 19, 47, 137, 176, 248, 321, 327, 340, 461
CviKI_1 RGCY 9 cut(s) 19, 47, 137, 176, 248, 321, 327, 340, 461
DdeI CTNAG 1 cut(s) 249
DpnI GATC 3 cut(s) 68, 132, 499
DpnII GATC 3 cut(s) 66, 130, 497
DraI TTTAAA 1 cut(s) 307
DraIII CACNNNGTG 1 cut(s) 111
DrdI GACNNNNNNGTC 1 cut(s) 487
DseDI GACNNNNNNGTC 1 cut(s) 487
Eco32I GATATC 1 cut(s) 430
Eco47I GGWCC 2 cut(s) 80, 524
Eco57I CTGAAG 1 cut(s) 307
EcoRII CCWGG 1 cut(s) 19
EcoRV GATATC 1 cut(s) 430
FaeI CATG 5 cut(s) 44, 76, 123, 300, 535
FatI CATG 5 cut(s) 40, 72, 119, 296, 531
Fnu4HI GCNGC 3 cut(s) 153, 341, 459
Fsp4HI GCNGC 3 cut(s) 153, 341, 459
FspBI CTAG 2 cut(s) 36, 416
GluI GCNGC 3 cut(s) 153, 341, 459
HapII CCGG 1 cut(s) 505
Hin1II CATG 5 cut(s) 44, 76, 123, 300, 535
HinfI GANTC 3 cut(s) 31, 277, 419
HpaII CCGG 1 cut(s) 505
Hpy166II GTNNAC 1 cut(s) 83
Hpy188I TCNGA 3 cut(s) 282, 502, 519
Hpy188III TCNNGA 2 cut(s) 251, 416
Hpy8I GTNNAC 1 cut(s) 83
HpyCH4V TGCA 5 cut(s) 155, 224, 266, 343, 365
HpyF10VI GCNNNNNNNGC 2 cut(s) 158, 455
HpyF3I CTNAG 1 cut(s) 249
Hsp92II CATG 5 cut(s) 44, 76, 123, 300, 535
Kzo9I GATC 3 cut(s) 66, 130, 497
LpnPI CCDG 9 cut(s) 6, 33, 42, 119, 141, 213, 236, 424, 518
Lsp1109I GCAGC 3 cut(s) 139, 327, 470
LweI GCATC 3 cut(s) 164, 253, 374
MaeI CTAG 2 cut(s) 36, 416
MaeIII GTNAC 3 cut(s) 169, 350, 478
MalI GATC 3 cut(s) 68, 132, 499
MboI GATC 3 cut(s) 66, 130, 497
MluCI AATT 3 cut(s) 219, 229, 284
MlyI GAGTC 1 cut(s) 413
MnlI CCTC 3 cut(s) 71, 108, 537
MseI TTAA 2 cut(s) 288, 306
MslI CAYNNNNRTG 1 cut(s) 348
MspI CCGG 1 cut(s) 505
MspR9I CCNGG 1 cut(s) 21
MvaI CCWGG 1 cut(s) 21
MwoI GCNNNNNNNGC 2 cut(s) 158, 455
NdeII GATC 3 cut(s) 66, 130, 497
NlaIII CATG 5 cut(s) 44, 76, 123, 300, 535
NlaIV GGNNCC 2 cut(s) 9, 126
NmuCI GTSAC 3 cut(s) 169, 350, 478
PfeI GAWTC 2 cut(s) 31, 277
PkrI GCNGC 3 cut(s) 154, 342, 460
PleI GAGTC 1 cut(s) 413
PpsI GAGTC 1 cut(s) 413
Psp6I CCWGG 1 cut(s) 19
PspGI CCWGG 1 cut(s) 19
PspN4I GGNNCC 2 cut(s) 9, 126
PspPI GGNCC 2 cut(s) 80, 524
RseI CAYNNNNRTG 1 cut(s) 348
SaqAI TTAA 2 cut(s) 288, 306
SatI GCNGC 3 cut(s) 153, 341, 459
Sau3AI GATC 3 cut(s) 66, 130, 497
Sau96I GGNCC 2 cut(s) 80, 524
SchI GAGTC 1 cut(s) 413
ScrFI CCNGG 1 cut(s) 21
SetI ASST 5 cut(s) 49, 82, 250, 329, 463
SfaNI GCATC 3 cut(s) 164, 253, 374
SinI GGWCC 2 cut(s) 80, 524
SmiMI CAYNNNNRTG 1 cut(s) 348
SmlI CTYRAG 1 cut(s) 433
SmoI CTYRAG 1 cut(s) 433
Sse9I AATT 3 cut(s) 219, 229, 284
SsiI CCGC 1 cut(s) 5
SspMI CTAG 2 cut(s) 36, 416
StyD4I CCNGG 1 cut(s) 19
TaqI TCGA 1 cut(s) 216
TaqII GACCGA 1 cut(s) 202
TasI AATT 3 cut(s) 219, 229, 284
TfiI GAWTC 2 cut(s) 31, 277
Tru1I TTAA 2 cut(s) 288, 306
Tru9I TTAA 2 cut(s) 288, 306
TseFI GTSAC 3 cut(s) 169, 350, 478
TseI GCWGC 3 cut(s) 152, 340, 458
Tsp45I GTSAC 3 cut(s) 169, 350, 478
TspDTI ATGAA 1 cut(s) 457
VpaK11BI GGWCC 2 cut(s) 80, 524
XapI RAATTY 1 cut(s) 284
XbaI TCTAGA 1 cut(s) 415
XspI CTAG 2 cut(s) 36, 416
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.