Rmu_co8162910.1_g000001

G-type lectin S-receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8162910.1
Physical Location & Seq
Forward (+)
1 .. 531
531 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8162910.1_g000001.1.cds

Sequence Viewer

Length: 301 bp
aggaaagccaattaagttgattgccatccttacagctattggtttaatgattatcttggttgccatactgttcggtttgcaaaaattgcgagctaaccaaaagggatcgattccaacttctagggatactcttcgagaatatattgggaaacatgatccatcagagctattgatctatgattttgataccatgctaactgctacagacaatttcagcattgcaaacaaactcgggcaaggaggctttggtcctgtttataaggtacttatttgtttacttgaggacaatatagcattgtaa

Protein Analysis

99

Amino Acids

10.82

Weight (kDa)

8.07

Isoelectric Point (pI)

31.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0025683)

Species Orthologous Gene IDs
rosa_multiflora Rmu_co8162910.1_g000001
rosa_roxburghii Rroxscaffold_1G00070220
rosa_samantha Rh4BG020800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 259
AclWI GGATC 2 cut(s) 113, 150
AfaI GTAC 1 cut(s) 265
AluBI AGCT 3 cut(s) 36, 93, 167
AluI AGCT 3 cut(s) 36, 93, 167
AlwI GGATC 2 cut(s) 113, 150
Ama87I CYCGRG 1 cut(s) 231
AspS9I GGNCC 1 cut(s) 249
AvaI CYCGRG 1 cut(s) 231
AvaII GGWCC 1 cut(s) 249
BccI CCATC 2 cut(s) 33, 167
BciVI GTATCC 1 cut(s) 119
BfaI CTAG 1 cut(s) 121
BfmI CTRYAG 1 cut(s) 202
BfuI GTATCC 1 cut(s) 119
Bme18I GGWCC 1 cut(s) 249
BmeT110I CYCGRG 1 cut(s) 231
BmgT120I GGNCC 1 cut(s) 249
BpuEI CTTGAG 1 cut(s) 300
Bsa29I ATCGAT 1 cut(s) 108
BsaBI GATNNNNATC 1 cut(s) 24
Bse3DI GCAATG 1 cut(s) 217
Bse8I GATNNNNATC 1 cut(s) 24
BseCI ATCGAT 1 cut(s) 108
BseGI GGATG 1 cut(s) 25
BseJI GATNNNNATC 1 cut(s) 24
BseMI GCAATG 1 cut(s) 217
BshVI ATCGAT 1 cut(s) 108
BsiHKCI CYCGRG 1 cut(s) 231
BsoBI CYCGRG 1 cut(s) 231
Bsp143I GATC 3 cut(s) 105, 155, 172
BspDI ATCGAT 1 cut(s) 108
BspPI GGATC 2 cut(s) 113, 150
BsrDI GCAATG 1 cut(s) 217
BssMI GATC 3 cut(s) 105, 155, 172
Bst4CI ACNGT 1 cut(s) 70
Bst6I CTCTTC 1 cut(s) 136
BstAPI GCANNNNNTGC 1 cut(s) 86
BstC8I GCNNGC 1 cut(s) 91
BstF5I GGATG 1 cut(s) 25
BstKTI GATC 3 cut(s) 108, 158, 175
BstMBI GATC 3 cut(s) 105, 155, 172
BstMWI GCNNNNNNNGC 1 cut(s) 86
BstSFI CTRYAG 1 cut(s) 202
Bsu15I ATCGAT 1 cut(s) 108
BsuI GTATCC 1 cut(s) 119
BsuTUI ATCGAT 1 cut(s) 108
BtsCI GGATG 1 cut(s) 25
Cac8I GCNNGC 1 cut(s) 91
Cfr13I GGNCC 1 cut(s) 249
ClaI ATCGAT 1 cut(s) 108
Csp6I GTAC 1 cut(s) 264
CviAII CATG 2 cut(s) 153, 191
CviJI RGCY 5 cut(s) 8, 36, 93, 167, 244
CviKI_1 RGCY 5 cut(s) 8, 36, 93, 167, 244
CviQI GTAC 1 cut(s) 264
DpnI GATC 3 cut(s) 107, 157, 174
DpnII GATC 3 cut(s) 105, 155, 172
Eam1104I CTCTTC 1 cut(s) 136
EarI CTCTTC 1 cut(s) 136
Eco47I GGWCC 1 cut(s) 249
Eco88I CYCGRG 1 cut(s) 231
FaeI CATG 2 cut(s) 156, 194
FaiI YATR 7 cut(s) 66, 142, 154, 178, 192, 259, 291
FatI CATG 2 cut(s) 152, 190
FokI GGATG 1 cut(s) 12
FspBI CTAG 1 cut(s) 121
Hin1II CATG 2 cut(s) 156, 194
HinfI GANTC 1 cut(s) 110
Hpy166II GTNNAC 1 cut(s) 276
Hpy188I TCNGA 1 cut(s) 164
Hpy188III TCNNGA 1 cut(s) 135
Hpy8I GTNNAC 1 cut(s) 276
HpyCH4III ACNGT 1 cut(s) 70
HpyCH4V TGCA 2 cut(s) 80, 222
HpyF10VI GCNNNNNNNGC 1 cut(s) 86
Hsp92II CATG 2 cut(s) 156, 194
Kzo9I GATC 3 cut(s) 105, 155, 172
LpnPI CCDG 1 cut(s) 265
MaeI CTAG 1 cut(s) 121
MalI GATC 3 cut(s) 107, 157, 174
MboI GATC 3 cut(s) 105, 155, 172
MboII GAAGA 1 cut(s) 123
MluCI AATT 3 cut(s) 10, 84, 209
MmeI TCCRAC 1 cut(s) 138
MnlI CCTC 2 cut(s) 234, 275
MseI TTAA 2 cut(s) 13, 45
MwoI GCNNNNNNNGC 1 cut(s) 86
NdeII GATC 3 cut(s) 105, 155, 172
NlaIII CATG 2 cut(s) 156, 194
PfeI GAWTC 1 cut(s) 110
PsiI TTATAA 1 cut(s) 259
PspPI GGNCC 1 cut(s) 249
RsaI GTAC 1 cut(s) 265
RsaNI GTAC 1 cut(s) 264
SaqAI TTAA 2 cut(s) 13, 45
Sau3AI GATC 3 cut(s) 105, 155, 172
Sau96I GGNCC 1 cut(s) 249
SetI ASST 4 cut(s) 38, 95, 169, 265
SfcI CTRYAG 1 cut(s) 202
SinI GGWCC 1 cut(s) 249
SmlI CTYRAG 1 cut(s) 279
SmoI CTYRAG 1 cut(s) 279
Sse9I AATT 3 cut(s) 10, 84, 209
SspMI CTAG 1 cut(s) 121
TaaI ACNGT 1 cut(s) 70
TaqI TCGA 2 cut(s) 108, 134
TasI AATT 3 cut(s) 10, 84, 209
TfiI GAWTC 1 cut(s) 110
Tru1I TTAA 2 cut(s) 13, 45
Tru9I TTAA 2 cut(s) 13, 45
VpaK11BI GGWCC 1 cut(s) 249
XspI CTAG 1 cut(s) 121
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.