Rmu_co8184688.1_g000001

Belongs to the cysteine synthase cystathionine beta- synthase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8184688.1
Physical Location & Seq
Reverse (-)
27 .. 356
330 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8184688.1_g000001.1.cds

Sequence Viewer

Length: 225 bp
atggtggaagagaaggcttggattgcaaaagatgttactgaattggttggcaacactccattggtgtatctcaaccatgtcgtagatggctgcgtggcacgggttgctgctaagctggagatgatggagccttgctctagtgtcaaggataggtacaaacaaattctttacattttggaatatctattggttgaacttgtgtgctttggagctgttcaattgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

74

Amino Acids

8.36

Weight (kDa)

4.94

Isoelectric Point (pI)

15.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022423)

Species Orthologous Gene IDs
malus_domestica MD05G1261300.v1.1
pyrus_communis pycom13g16560
rosa_chinensis RchiOBHm_Chr3g0452921
rosa_multiflora Rmu_co8184688.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 162
AfaI GTAC 1 cut(s) 155
AgsI TTSAA 2 cut(s) 194, 218
AluBI AGCT 2 cut(s) 115, 212
AluI AGCT 2 cut(s) 115, 212
ApeKI GCWGC 2 cut(s) 90, 107
ApoI RAATTY 1 cut(s) 162
BbvI GCAGC 2 cut(s) 77, 94
BccI CCATC 2 cut(s) 80, 118
BfaI CTAG 1 cut(s) 138
BisI GCNGC 2 cut(s) 91, 108
BlpI GCTNAGC 1 cut(s) 111
BlsI GCNGC 2 cut(s) 92, 109
BmiI GGNNCC 1 cut(s) 129
BplI GAGNNNNNCTC 2 cut(s) 119, 151
BpmI CTGGAG 1 cut(s) 137
Bpu1102I GCTNAGC 1 cut(s) 111
BseXI GCAGC 2 cut(s) 77, 94
Bsp1720I GCTNAGC 1 cut(s) 111
BspLI GGNNCC 1 cut(s) 129
Bst6I CTCTTC 1 cut(s) 3
BstAPI GCANNNNNTGC 1 cut(s) 104
BstDEI CTNAG 1 cut(s) 111
BstMWI GCNNNNNNNGC 2 cut(s) 23, 104
BstV1I GCAGC 2 cut(s) 77, 94
Csp6I GTAC 1 cut(s) 154
CviAII CATG 1 cut(s) 77
CviJI RGCY 5 cut(s) 17, 90, 115, 130, 212
CviKI_1 RGCY 5 cut(s) 17, 90, 115, 130, 212
CviQI GTAC 1 cut(s) 154
DdeI CTNAG 1 cut(s) 111
Eam1104I CTCTTC 1 cut(s) 3
EarI CTCTTC 1 cut(s) 3
FaeI CATG 1 cut(s) 80
FaiI YATR 1 cut(s) 78
FatI CATG 1 cut(s) 76
Fnu4HI GCNGC 2 cut(s) 91, 108
Fsp4HI GCNGC 2 cut(s) 91, 108
FspBI CTAG 1 cut(s) 138
GluI GCNGC 2 cut(s) 91, 108
GsuI CTGGAG 1 cut(s) 137
Hin1II CATG 1 cut(s) 80
HpyAV CCTTC 1 cut(s) 7
HpyCH4V TGCA 1 cut(s) 26
HpyF10VI GCNNNNNNNGC 2 cut(s) 23, 104
HpyF3I CTNAG 1 cut(s) 111
Hsp92II CATG 1 cut(s) 80
LmnI GCTCC 2 cut(s) 127, 209
LpnPI CCDG 1 cut(s) 101
Lsp1109I GCAGC 2 cut(s) 77, 94
MaeI CTAG 1 cut(s) 138
MaeIII GTNAC 1 cut(s) 34
MboII GAAGA 1 cut(s) 20
MfeI CAATTG 1 cut(s) 218
MluCI AATT 3 cut(s) 41, 162, 218
MunI CAATTG 1 cut(s) 218
MwoI GCNNNNNNNGC 2 cut(s) 23, 104
NlaIII CATG 1 cut(s) 80
NlaIV GGNNCC 1 cut(s) 129
PkrI GCNGC 2 cut(s) 92, 109
PspN4I GGNNCC 1 cut(s) 129
RsaI GTAC 1 cut(s) 155
RsaNI GTAC 1 cut(s) 154
SatI GCNGC 2 cut(s) 91, 108
SetI ASST 3 cut(s) 117, 155, 214
Sse9I AATT 3 cut(s) 41, 162, 218
SspMI CTAG 1 cut(s) 138
TasI AATT 3 cut(s) 41, 162, 218
TseI GCWGC 2 cut(s) 90, 107
XapI RAATTY 1 cut(s) 162
XcmI CCANNNNNNNNNTGG 1 cut(s) 83
XspI CTAG 1 cut(s) 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.