Rmu_co8185036.1_g000001

receptor-like protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8185036.1
Physical Location & Seq
Forward (+)
1 .. 691
691 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8185036.1_g000001.1.cds

Sequence Viewer

Length: 691 bp
tgtattactcgagtagggagttaaaacttgagaacccgaatttaggcactttaatccagaaccttacagagcttactgagttaaatcttggtggtctaaacctatcagctgagggatctcactggggccaaaccatatcatcttcacttccaaagctgagtctgttgaccttgtccggttgtcatctttcaggccctattcatgaatcattggtcaggcttcattctctatccatgttagtattggatgacaactacatctctggtccggttccaaaattctttgccaatttttcaagtttgatttccttgagtctctctgcctgtaacttgtacgaagcatttcccaaagagatattcctggtacctacactacagtctgttgacctatcagctaattcagagcttcgtggttccttgccggagtttccaaagaatggatctctccaatccctagttctatccgggactaagttctcaggagtcttgccggattctattggcaaccttaaaatgctgtctgaattacatcttaaagattgcaatttcacaggagcagttccaaagtcactggcaaacctaacacaattgggatatttggacttgtcatacaacaagttttctagtccgattaattctattcaatgggacaaactcatcaagcttgtggatctcgacttgtccgacaatct
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

230

Amino Acids

25.06

Weight (kDa)

5.31

Isoelectric Point (pI)

35.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0023067)

Species Orthologous Gene IDs
rosa_multiflora Rmu_co8185036.1_g000001 Rmu_sc0001431.1_g000001
rosa_samantha Rh1DG014000 Rh1DG014300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 363
AccB1I GGYRCC 1 cut(s) 363
AccB7I CCANNNNNTGG 1 cut(s) 436
AclWI GGATC 3 cut(s) 123, 447, 677
AcsI RAATTY 2 cut(s) 39, 277
AfaI GTAC 2 cut(s) 334, 365
AfiI CCNNNNNNNGG 2 cut(s) 43, 436
AgsI TTSAA 2 cut(s) 296, 643
AjnI CCWGG 1 cut(s) 359
AjuI GAANNNNNNNTTGG 4 cut(s) 340, 372, 440, 472
AluBI AGCT 6 cut(s) 72, 109, 156, 394, 405, 663
AluI AGCT 6 cut(s) 72, 109, 156, 394, 405, 663
Alw26I GTCTC 1 cut(s) 319
AlwI GGATC 3 cut(s) 123, 447, 677
Ama87I CYCGRG 1 cut(s) 9
AoxI GGCC 2 cut(s) 126, 192
ApoI RAATTY 2 cut(s) 39, 277
AseI ATTAAT 1 cut(s) 632
Asp700I GAANNNNTTC 1 cut(s) 341
Asp718I GGTACC 1 cut(s) 363
AspS9I GGNCC 3 cut(s) 126, 193, 265
AsuC2I CCSGG 1 cut(s) 465
AvaI CYCGRG 1 cut(s) 9
AvaII GGWCC 1 cut(s) 265
BanI GGYRCC 1 cut(s) 363
BbvCI CCTCAGC 1 cut(s) 110
BciT130I CCWGG 1 cut(s) 361
BcnI CCSGG 1 cut(s) 465
BcoDI GTCTC 1 cut(s) 319
BfaI CTAG 2 cut(s) 454, 623
BfmI CTRYAG 1 cut(s) 373
Bme1390I CCNGG 2 cut(s) 361, 465
Bme18I GGWCC 1 cut(s) 265
BmeT110I CYCGRG 1 cut(s) 9
BmgT120I GGNCC 3 cut(s) 126, 193, 265
BmiI GGNNCC 4 cut(s) 127, 272, 365, 414
BmrFI CCNGG 2 cut(s) 361, 465
BmrI ACTGGG 1 cut(s) 132
BmuI ACTGGG 1 cut(s) 132
Bpu10I CCTNAGC 1 cut(s) 110
BpuEI CTTGAG 2 cut(s) 49, 330
BpuMI CCSGG 1 cut(s) 465
BsaWI WCCGGW 2 cut(s) 175, 267
Bsc4I CCNNNNNNNGG 2 cut(s) 43, 436
Bse1I ACTGG 2 cut(s) 127, 575
BseBI CCWGG 1 cut(s) 361
BseGI GGATG 1 cut(s) 252
BseLI CCNNNNNNNGG 2 cut(s) 43, 436
BseMII CTCAG 4 cut(s) 68, 101, 148, 491
BseNI ACTGG 2 cut(s) 127, 575
BshFI GGCC 2 cut(s) 128, 194
BshNI GGYRCC 1 cut(s) 363
BsiHKCI CYCGRG 1 cut(s) 9
BsiSI CCGG 5 cut(s) 176, 268, 421, 464, 490
BslFI GGGAC 2 cut(s) 480, 661
BslI CCNNNNNNNGG 2 cut(s) 43, 436
BsmAI GTCTC 1 cut(s) 319
BsmFI GGGAC 2 cut(s) 480, 661
BsnI GGCC 2 cut(s) 128, 194
BsoBI CYCGRG 1 cut(s) 9
Bsp143I GATC 3 cut(s) 115, 439, 669
BspANI GGCC 2 cut(s) 128, 194
BspCNI CTCAG 4 cut(s) 69, 102, 149, 490
BspHI TCATGA 1 cut(s) 201
BspLI GGNNCC 4 cut(s) 127, 272, 365, 414
BspPI GGATC 3 cut(s) 123, 447, 677
BspT107I GGYRCC 1 cut(s) 363
BsrI ACTGG 2 cut(s) 127, 575
BssMI GATC 3 cut(s) 115, 439, 669
Bst2UI CCWGG 1 cut(s) 361
Bst4CI ACNGT 1 cut(s) 377
BstDEI CTNAG 5 cut(s) 77, 110, 157, 470, 477
BstF5I GGATG 1 cut(s) 252
BstKTI GATC 3 cut(s) 118, 442, 672
BstMAI GTCTC 1 cut(s) 319
BstMBI GATC 3 cut(s) 115, 439, 669
BstNI CCWGG 1 cut(s) 361
BstSCI CCNGG 2 cut(s) 359, 463
BstSFI CTRYAG 1 cut(s) 373
BstX2I RGATCY 3 cut(s) 115, 439, 669
BstYI RGATCY 3 cut(s) 115, 439, 669
BsuRI GGCC 2 cut(s) 128, 194
BtsCI GGATG 1 cut(s) 252
BtsIMutI CAGTG 2 cut(s) 120, 568
CciI TCATGA 1 cut(s) 201
Cfr13I GGNCC 3 cut(s) 126, 193, 265
Csp6I GTAC 2 cut(s) 333, 364
CviAII CATG 2 cut(s) 202, 234
CviJI RGCY 9 cut(s) 72, 109, 128, 156, 194, 219, 394, 405, 663
CviKI_1 RGCY 9 cut(s) 72, 109, 128, 156, 194, 219, 394, 405, 663
CviQI GTAC 2 cut(s) 333, 364
DdeI CTNAG 5 cut(s) 77, 110, 157, 470, 477
DpnI GATC 3 cut(s) 117, 441, 671
DpnII GATC 3 cut(s) 115, 439, 669
Eco47I GGWCC 1 cut(s) 265
Eco88I CYCGRG 1 cut(s) 9
EcoO109I RGGNCCY 1 cut(s) 193
EcoRII CCWGG 1 cut(s) 359
FaeI CATG 2 cut(s) 205, 237
FaiI YATR 4 cut(s) 136, 203, 235, 609
FaqI GGGAC 2 cut(s) 480, 661
FatI CATG 2 cut(s) 201, 233
FokI GGATG 1 cut(s) 259
FspBI CTAG 2 cut(s) 454, 623
HaeIII GGCC 2 cut(s) 128, 194
HapII CCGG 5 cut(s) 176, 268, 421, 464, 490
Hin1II CATG 2 cut(s) 205, 237
HincII GTYRAC 2 cut(s) 167, 384
HindII GTYRAC 2 cut(s) 167, 384
HindIII AAGCTT 1 cut(s) 661
HinfI GANTC 5 cut(s) 159, 205, 312, 482, 493
HpaII CCGG 5 cut(s) 176, 268, 421, 464, 490
Hpy166II GTNNAC 2 cut(s) 167, 384
Hpy188I TCNGA 4 cut(s) 402, 522, 629, 684
Hpy188III TCNNGA 4 cut(s) 57, 202, 479, 673
Hpy8I GTNNAC 2 cut(s) 167, 384
HpyCH4III ACNGT 1 cut(s) 377
HpyCH4V TGCA 1 cut(s) 542
HpyF3I CTNAG 5 cut(s) 77, 110, 157, 470, 477
Hsp92II CATG 2 cut(s) 205, 237
KpnI GGTACC 1 cut(s) 367
Kzo9I GATC 3 cut(s) 115, 439, 669
LmnI GCTCC 1 cut(s) 553
MaeI CTAG 2 cut(s) 454, 623
MaeIII GTNAC 2 cut(s) 325, 566
MalI GATC 3 cut(s) 117, 441, 671
MboI GATC 3 cut(s) 115, 439, 669
MboII GAAGA 1 cut(s) 134
MfeI CAATTG 1 cut(s) 586
MflI RGATCY 3 cut(s) 115, 439, 669
MluCI AATT 8 cut(s) 39, 277, 288, 396, 523, 543, 586, 633
MlyI GAGTC 3 cut(s) 168, 321, 491
MnlI CCTC 1 cut(s) 105
MroXI GAANNNNTTC 1 cut(s) 341
MseI TTAA 6 cut(s) 22, 52, 82, 509, 533, 632
MspA1I CMGCKG 1 cut(s) 109
MspI CCGG 5 cut(s) 176, 268, 421, 464, 490
MspR9I CCNGG 2 cut(s) 361, 465
MunI CAATTG 1 cut(s) 586
MvaI CCWGG 1 cut(s) 361
NciI CCSGG 1 cut(s) 465
NdeII GATC 3 cut(s) 115, 439, 669
NlaIII CATG 2 cut(s) 205, 237
NlaIV GGNNCC 4 cut(s) 127, 272, 365, 414
NmuCI GTSAC 1 cut(s) 566
PaeR7I CTCGAG 1 cut(s) 9
PagI TCATGA 1 cut(s) 201
PcsI WCGNNNNNNNCGW 1 cut(s) 680
PdmI GAANNNNTTC 1 cut(s) 341
PfeI GAWTC 2 cut(s) 205, 493
PflFI GACNNNGTC 1 cut(s) 171
PflMI CCANNNNNTGG 1 cut(s) 436
PfoI TCCNGGA 1 cut(s) 463
PleI GAGTC 3 cut(s) 167, 320, 490
PpsI GAGTC 3 cut(s) 167, 320, 490
PshBI ATTAAT 1 cut(s) 632
Psp6I CCWGG 1 cut(s) 359
PspGI CCWGG 1 cut(s) 359
PspN4I GGNNCC 4 cut(s) 127, 272, 365, 414
PspPI GGNCC 3 cut(s) 126, 193, 265
PspXI VCTCGAGB 1 cut(s) 9
PsuI RGATCY 3 cut(s) 115, 439, 669
PsyI GACNNNGTC 1 cut(s) 171
PvuII CAGCTG 1 cut(s) 109
RsaI GTAC 2 cut(s) 334, 365
RsaNI GTAC 2 cut(s) 333, 364
SaqAI TTAA 6 cut(s) 22, 52, 82, 509, 533, 632
Sau3AI GATC 3 cut(s) 115, 439, 669
Sau96I GGNCC 3 cut(s) 126, 193, 265
SchI GAGTC 3 cut(s) 168, 321, 491
ScrFI CCNGG 2 cut(s) 361, 465
SfcI CTRYAG 1 cut(s) 373
Sfr274I CTCGAG 1 cut(s) 9
SinI GGWCC 1 cut(s) 265
SlaI CTCGAG 1 cut(s) 9
SmlI CTYRAG 3 cut(s) 9, 28, 309
SmoI CTYRAG 3 cut(s) 9, 28, 309
Sse9I AATT 8 cut(s) 39, 277, 288, 396, 523, 543, 586, 633
SspMI CTAG 2 cut(s) 454, 623
StyD4I CCNGG 2 cut(s) 359, 463
TaaI ACNGT 1 cut(s) 377
TaqI TCGA 2 cut(s) 10, 674
TasI AATT 8 cut(s) 39, 277, 288, 396, 523, 543, 586, 633
TfiI GAWTC 2 cut(s) 205, 493
Tru1I TTAA 6 cut(s) 22, 52, 82, 509, 533, 632
Tru9I TTAA 6 cut(s) 22, 52, 82, 509, 533, 632
TscAI CASTG 2 cut(s) 127, 575
TseFI GTSAC 1 cut(s) 566
Tsp45I GTSAC 1 cut(s) 566
TspDTI ATGAA 3 cut(s) 190, 211, 218
TspRI CASTG 2 cut(s) 127, 575
Tth111I GACNNNGTC 1 cut(s) 171
Van91I CCANNNNNTGG 1 cut(s) 436
VpaK11BI GGWCC 1 cut(s) 265
VspI ATTAAT 1 cut(s) 632
XapI RAATTY 2 cut(s) 39, 277
XcmI CCANNNNNNNNNTGG 1 cut(s) 240
XhoI CTCGAG 1 cut(s) 9
XmnI GAANNNNTTC 1 cut(s) 341
XspI CTAG 2 cut(s) 454, 623
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.