Rmu_sc0001431.1_g000001

receptor-like protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001431.1
Physical Location & Seq
Forward (+)
102 .. 806
705 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001431.1_g000001.1.cds

Sequence Viewer

Length: 705 bp
atgaatgcattagactatatcatcacagagcttactgacctaaatcttaatggtctaaacctatcagctgagggatctctatggagccaaaccatatcatcttcacttccaaagctgagtgcgttgaccttgtctgattgtgagctttcaggccctattcatgaatcatttgccaggcttcattctctatccatgttaatattggataacaacaacatctctgctccagttcctaaaatttttgccaatttttcaagcttgatttccctagatctctcacattgtaacatccatggagcatttcccaaagagatattccaggtacctacactacagtctgttgtcctatcatataattcagagtttcgtggttccttaccggagtttccaaagaatggatctctcgaattcctagtccttagcaggactaaattttcaggagtcttgtcggactctattggcaaccttaaattgctgtctagattagatctttcatattgcaatttcacaggagtggttccaaagtcactggcaaacctaacacaattggaggatttggccttgtcatccaacaagttttctagtccgataaattctattcaatgggacaaactcatcaagcttgacagtctccacttggccaacaatctgctctatgggagtattccattgtctcccttttctattccttgctatagagcttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

234

Amino Acids

25.61

Weight (kDa)

5.68

Isoelectric Point (pI)

36.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0023067)

Species Orthologous Gene IDs
rosa_multiflora Rmu_co8185036.1_g000001 Rmu_sc0001431.1_g000001
rosa_samantha Rh1DG014000 Rh1DG014300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 322
AccB1I GGYRCC 1 cut(s) 322
AccB7I CCANNNNNTGG 1 cut(s) 395
AclWI GGATC 2 cut(s) 82, 406
AcoI YGGCCR 1 cut(s) 639
AcsI RAATTY 4 cut(s) 237, 407, 431, 592
AfaI GTAC 1 cut(s) 324
AfiI CCNNNNNNNGG 1 cut(s) 395
AgsI TTSAA 2 cut(s) 255, 602
AjnI CCWGG 2 cut(s) 173, 318
AjuI GAANNNNNNNTTGG 2 cut(s) 299, 331
AleI CACNNNNGTG 1 cut(s) 512
AluBI AGCT 7 cut(s) 31, 68, 115, 145, 258, 622, 701
AluI AGCT 7 cut(s) 31, 68, 115, 145, 258, 622, 701
Alw26I GTCTC 2 cut(s) 635, 678
AlwI GGATC 2 cut(s) 82, 406
AoxI GGCC 3 cut(s) 151, 558, 639
ApoI RAATTY 4 cut(s) 237, 407, 431, 592
ArsI GACNNNNNNTTYG 2 cut(s) 399, 431
Asp718I GGTACC 1 cut(s) 322
AspS9I GGNCC 1 cut(s) 152
BalI TGGCCA 1 cut(s) 641
BanI GGYRCC 1 cut(s) 322
BbvCI CCTCAGC 1 cut(s) 69
BciT130I CCWGG 2 cut(s) 175, 320
BcoDI GTCTC 2 cut(s) 635, 678
BfaI CTAG 4 cut(s) 269, 413, 480, 582
BfmI CTRYAG 2 cut(s) 332, 694
BglII AGATCT 2 cut(s) 271, 487
Bme1390I CCNGG 2 cut(s) 175, 320
BmgT120I GGNCC 1 cut(s) 152
BmiI GGNNCC 4 cut(s) 86, 324, 373, 519
BmrFI CCNGG 2 cut(s) 175, 320
BpmI CTGGAG 1 cut(s) 210
Bpu10I CCTNAGC 2 cut(s) 69, 419
BsaJI CCNNGG 1 cut(s) 292
BsaWI WCCGGW 1 cut(s) 379
Bsc4I CCNNNNNNNGG 1 cut(s) 395
Bse1I ACTGG 2 cut(s) 227, 534
BseBI CCWGG 2 cut(s) 175, 320
BseDI CCNNGG 1 cut(s) 292
BseGI GGATG 2 cut(s) 288, 566
BseLI CCNNNNNNNGG 1 cut(s) 395
BseMII CTCAG 2 cut(s) 60, 107
BseNI ACTGG 2 cut(s) 227, 534
BshFI GGCC 3 cut(s) 153, 560, 641
BshNI GGYRCC 1 cut(s) 322
BsiSI CCGG 1 cut(s) 380
BslFI GGGAC 1 cut(s) 620
BslI CCNNNNNNNGG 1 cut(s) 395
BsmAI GTCTC 2 cut(s) 635, 678
BsmFI GGGAC 1 cut(s) 620
BsmI GAATGC 1 cut(s) 10
BsnI GGCC 3 cut(s) 153, 560, 641
Bsp143I GATC 4 cut(s) 74, 271, 398, 487
Bsp19I CCATGG 1 cut(s) 292
BspANI GGCC 3 cut(s) 153, 560, 641
BspCNI CTCAG 2 cut(s) 61, 108
BspHI TCATGA 1 cut(s) 160
BspLI GGNNCC 4 cut(s) 86, 324, 373, 519
BspPI GGATC 2 cut(s) 82, 406
BspT107I GGYRCC 1 cut(s) 322
BsrI ACTGG 2 cut(s) 227, 534
BssECI CCNNGG 1 cut(s) 292
BssMI GATC 4 cut(s) 74, 271, 398, 487
BssT1I CCWWGG 1 cut(s) 292
Bst2UI CCWGG 2 cut(s) 175, 320
Bst4CI ACNGT 2 cut(s) 336, 629
BstDEI CTNAG 3 cut(s) 69, 116, 419
BstDSI CCRYGG 1 cut(s) 292
BstF5I GGATG 2 cut(s) 288, 566
BstKTI GATC 4 cut(s) 77, 274, 401, 490
BstMAI GTCTC 2 cut(s) 635, 678
BstMBI GATC 4 cut(s) 74, 271, 398, 487
BstNI CCWGG 2 cut(s) 175, 320
BstSCI CCNGG 2 cut(s) 173, 318
BstSFI CTRYAG 2 cut(s) 332, 694
BstX2I RGATCY 4 cut(s) 74, 271, 398, 487
BstYI RGATCY 4 cut(s) 74, 271, 398, 487
BsuRI GGCC 3 cut(s) 153, 560, 641
BtgI CCRYGG 1 cut(s) 292
BtsCI GGATG 2 cut(s) 288, 566
BtsIMutI CAGTG 1 cut(s) 527
CciI TCATGA 1 cut(s) 160
Cfr13I GGNCC 1 cut(s) 152
Csp6I GTAC 1 cut(s) 323
CviAII CATG 3 cut(s) 161, 193, 293
CviQI GTAC 1 cut(s) 323
DdeI CTNAG 3 cut(s) 69, 116, 419
DpnI GATC 4 cut(s) 76, 273, 400, 489
DpnII GATC 4 cut(s) 74, 271, 398, 487
EaeI YGGCCR 1 cut(s) 639
Eco130I CCWWGG 1 cut(s) 292
EcoO109I RGGNCCY 1 cut(s) 152
EcoRI GAATTC 1 cut(s) 407
EcoRII CCWGG 2 cut(s) 173, 318
EcoT14I CCWWGG 1 cut(s) 292
EcoT22I ATGCAT 1 cut(s) 10
ErhI CCWWGG 1 cut(s) 292
FaeI CATG 3 cut(s) 164, 196, 296
FaqI GGGAC 1 cut(s) 620
FatI CATG 3 cut(s) 160, 192, 292
FokI GGATG 2 cut(s) 275, 553
FspBI CTAG 4 cut(s) 269, 413, 480, 582
GsuI CTGGAG 1 cut(s) 210
HaeIII GGCC 3 cut(s) 153, 560, 641
HapII CCGG 1 cut(s) 380
Hin1II CATG 3 cut(s) 164, 196, 296
HincII GTYRAC 1 cut(s) 126
HindII GTYRAC 1 cut(s) 126
HindIII AAGCTT 2 cut(s) 256, 620
HinfI GANTC 3 cut(s) 164, 441, 452
HpaII CCGG 1 cut(s) 380
Hpy166II GTNNAC 1 cut(s) 126
Hpy188I TCNGA 4 cut(s) 136, 361, 451, 588
Hpy188III TCNNGA 4 cut(s) 161, 404, 438, 480
Hpy8I GTNNAC 1 cut(s) 126
HpyCH4III ACNGT 2 cut(s) 336, 629
HpyCH4V TGCA 2 cut(s) 8, 501
HpyF3I CTNAG 3 cut(s) 69, 116, 419
Hsp92II CATG 3 cut(s) 164, 196, 296
KpnI GGTACC 1 cut(s) 326
Kzo9I GATC 4 cut(s) 74, 271, 398, 487
LmnI GCTCC 3 cut(s) 84, 229, 296
MaeI CTAG 4 cut(s) 269, 413, 480, 582
MaeIII GTNAC 2 cut(s) 284, 525
MalI GATC 4 cut(s) 76, 273, 400, 489
MboI GATC 4 cut(s) 74, 271, 398, 487
MboII GAAGA 1 cut(s) 93
MfeI CAATTG 1 cut(s) 545
MflI RGATCY 4 cut(s) 74, 271, 398, 487
MlsI TGGCCA 1 cut(s) 641
MluCI AATT 9 cut(s) 237, 247, 355, 407, 431, 470, 502, 545, 592
MluNI TGGCCA 1 cut(s) 641
MlyI GAGTC 2 cut(s) 446, 450
MmeI TCCRAC 2 cut(s) 429, 594
MnlI CCTC 2 cut(s) 64, 544
Mox20I TGGCCA 1 cut(s) 641
Mph1103I ATGCAT 1 cut(s) 10
MscI TGGCCA 1 cut(s) 641
MseI TTAA 4 cut(s) 48, 197, 468, 703
MslI CAYNNNNRTG 1 cut(s) 512
Msp20I TGGCCA 1 cut(s) 641
MspA1I CMGCKG 1 cut(s) 68
MspI CCGG 1 cut(s) 380
MspR9I CCNGG 2 cut(s) 175, 320
MunI CAATTG 1 cut(s) 545
Mva1269I GAATGC 1 cut(s) 10
MvaI CCWGG 2 cut(s) 175, 320
NcoI CCATGG 1 cut(s) 292
NdeII GATC 4 cut(s) 74, 271, 398, 487
NlaIII CATG 3 cut(s) 164, 196, 296
NlaIV GGNNCC 4 cut(s) 86, 324, 373, 519
NmuCI GTSAC 1 cut(s) 525
NsiI ATGCAT 1 cut(s) 10
OliI CACNNNNGTG 1 cut(s) 512
PagI TCATGA 1 cut(s) 160
PctI GAATGC 1 cut(s) 10
PfeI GAWTC 1 cut(s) 164
PflFI GACNNNGTC 1 cut(s) 130
PflMI CCANNNNNTGG 1 cut(s) 395
PleI GAGTC 2 cut(s) 446, 449
PpsI GAGTC 2 cut(s) 446, 449
Psp6I CCWGG 2 cut(s) 173, 318
PspGI CCWGG 2 cut(s) 173, 318
PspN4I GGNNCC 4 cut(s) 86, 324, 373, 519
PspPI GGNCC 1 cut(s) 152
PsuI RGATCY 4 cut(s) 74, 271, 398, 487
PsyI GACNNNGTC 1 cut(s) 130
PvuII CAGCTG 1 cut(s) 68
RsaI GTAC 1 cut(s) 324
RsaNI GTAC 1 cut(s) 323
RseI CAYNNNNRTG 1 cut(s) 512
SaqAI TTAA 4 cut(s) 48, 197, 468, 703
Sau3AI GATC 4 cut(s) 74, 271, 398, 487
Sau96I GGNCC 1 cut(s) 152
SchI GAGTC 2 cut(s) 446, 450
ScrFI CCNGG 2 cut(s) 175, 320
SfcI CTRYAG 2 cut(s) 332, 694
SmiMI CAYNNNNRTG 1 cut(s) 512
Sse9I AATT 9 cut(s) 237, 247, 355, 407, 431, 470, 502, 545, 592
SspI AATATT 1 cut(s) 201
SspMI CTAG 4 cut(s) 269, 413, 480, 582
StyD4I CCNGG 2 cut(s) 173, 318
StyI CCWWGG 1 cut(s) 292
TaaI ACNGT 2 cut(s) 336, 629
TaqI TCGA 1 cut(s) 405
TasI AATT 9 cut(s) 237, 247, 355, 407, 431, 470, 502, 545, 592
TfiI GAWTC 1 cut(s) 164
Tru1I TTAA 4 cut(s) 48, 197, 468, 703
Tru9I TTAA 4 cut(s) 48, 197, 468, 703
TscAI CASTG 1 cut(s) 534
TseFI GTSAC 1 cut(s) 525
Tsp45I GTSAC 1 cut(s) 525
TspDTI ATGAA 5 cut(s) 17, 149, 170, 177, 483
TspRI CASTG 1 cut(s) 534
Tth111I GACNNNGTC 1 cut(s) 130
Van91I CCANNNNNTGG 1 cut(s) 395
XapI RAATTY 4 cut(s) 237, 407, 431, 592
XbaI TCTAGA 1 cut(s) 479
XcmI CCANNNNNNNNNTGG 1 cut(s) 199
XspI CTAG 4 cut(s) 269, 413, 480, 582
Zsp2I ATGCAT 1 cut(s) 10
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.