Rmu_co8203264.1_g000001

Ubiquitin-conjugating enzyme E2 variant

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8203264.1
Physical Location & Seq
Reverse (-)
375 .. 686
312 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8203264.1_g000001.1.cds

Sequence Viewer

Length: 312 bp
atgtcttttgatgctgtgcactgtgcagtgccacgaaatttcaggttgctggaggaacttgaacgtggagagaagggcatcggagatggtactgtcagttatggaatggatgatggagatgacatttatatgcgctcctggacgggtactataattggcccacataatgtaagcaagtgcgtcagtactaatgcccctcccaaatatatatatccaccaccaccccccctcctcctcctctttcctcctcctcctctcacggcgactaacctcttgattccattattttatattggatgcattaatacataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

103

Amino Acids

11.32

Weight (kDa)

5.1

Isoelectric Point (pI)

39.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021258)

Species Orthologous Gene IDs
pyrus_communis pycom03g10570 pycom11g14450
rosa_multiflora Rmu_co8203264.1_g000001
rosa_samantha Rh3BG227700 Rh3DG222900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 37
AfaI GTAC 3 cut(s) 91, 148, 187
AgsI TTSAA 1 cut(s) 62
AjnI CCWGG 1 cut(s) 137
Alw21I GWGCWC 1 cut(s) 21
Alw44I GTGCAC 1 cut(s) 17
AoxI GGCC 1 cut(s) 157
ApaLI GTGCAC 1 cut(s) 17
ApoI RAATTY 1 cut(s) 37
AseI ATTAAT 1 cut(s) 303
AspLEI GCGC 1 cut(s) 135
AspS9I GGNCC 1 cut(s) 158
BaeGI GKGCMC 1 cut(s) 21
Bbv12I GWGCWC 1 cut(s) 21
BccI CCATC 2 cut(s) 80, 107
BceAI ACGGC 1 cut(s) 276
BciT130I CCWGG 1 cut(s) 139
BmcAI AGTACT 1 cut(s) 187
Bme1390I CCNGG 1 cut(s) 139
BmgT120I GGNCC 1 cut(s) 158
BmrFI CCNGG 1 cut(s) 139
BmsI GCATC 2 cut(s) 87, 287
BpmI CTGGAG 1 cut(s) 71
BsaXI ACNNNNNCTCC 2 cut(s) 213, 243
BseBI CCWGG 1 cut(s) 139
BseGI GGATG 2 cut(s) 115, 302
BseRI GAGGAG 6 cut(s) 221, 224, 227, 237, 240, 243
BseSI GKGCMC 1 cut(s) 21
BsgI GTGCAG 1 cut(s) 45
BshFI GGCC 1 cut(s) 159
BsiHKAI GWGCWC 1 cut(s) 21
BsnI GGCC 1 cut(s) 159
Bsp1286I GDGCHC 1 cut(s) 21
BspANI GGCC 1 cut(s) 159
Bst2UI CCWGG 1 cut(s) 139
Bst4CI ACNGT 2 cut(s) 23, 94
BstF5I GGATG 2 cut(s) 115, 302
BstHHI GCGC 1 cut(s) 135
BstNI CCWGG 1 cut(s) 139
BstSCI CCNGG 1 cut(s) 137
BstSLI GKGCMC 1 cut(s) 21
BsuRI GGCC 1 cut(s) 159
BtsCI GGATG 2 cut(s) 115, 302
BtsI GCAGTG 1 cut(s) 33
BtsIMutI CAGTG 2 cut(s) 19, 33
CfoI GCGC 1 cut(s) 135
Cfr13I GGNCC 1 cut(s) 158
CseI GACGC 1 cut(s) 169
Csp6I GTAC 3 cut(s) 90, 147, 186
CviJI RGCY 1 cut(s) 159
CviKI_1 RGCY 1 cut(s) 159
CviQI GTAC 3 cut(s) 90, 147, 186
EcoRII CCWGG 1 cut(s) 137
EcoT22I ATGCAT 1 cut(s) 302
FokI GGATG 1 cut(s) 122
GlaI GCGC 1 cut(s) 134
GsuI CTGGAG 1 cut(s) 71
HaeIII GGCC 1 cut(s) 159
HgaI GACGC 1 cut(s) 169
HhaI GCGC 1 cut(s) 135
Hin6I GCGC 1 cut(s) 133
HinP1I GCGC 1 cut(s) 133
HinfI GANTC 1 cut(s) 277
Hpy166II GTNNAC 1 cut(s) 19
Hpy188I TCNGA 1 cut(s) 83
Hpy188III TCNNGA 1 cut(s) 274
Hpy8I GTNNAC 1 cut(s) 19
HpyAV CCTTC 1 cut(s) 67
HpyCH4III ACNGT 2 cut(s) 23, 94
HpyCH4IV ACGT 1 cut(s) 64
HpyCH4V TGCA 3 cut(s) 19, 26, 300
HpySE526I ACGT 1 cut(s) 64
HspAI GCGC 1 cut(s) 133
LmnI GCTCC 1 cut(s) 140
LpnPI CCDG 4 cut(s) 28, 35, 124, 151
LweI GCATC 2 cut(s) 87, 287
MaeII ACGT 1 cut(s) 64
MhlI GDGCHC 1 cut(s) 21
MluCI AATT 2 cut(s) 37, 153
Mph1103I ATGCAT 1 cut(s) 302
MseI TTAA 1 cut(s) 303
MslI CAYNNNNRTG 1 cut(s) 128
MspR9I CCNGG 1 cut(s) 139
MvaI CCWGG 1 cut(s) 139
NsiI ATGCAT 1 cut(s) 302
PfeI GAWTC 1 cut(s) 277
PfoI TCCNGGA 1 cut(s) 137
PshBI ATTAAT 1 cut(s) 303
Psp6I CCWGG 1 cut(s) 137
PspGI CCWGG 1 cut(s) 137
PspPI GGNCC 1 cut(s) 158
RsaI GTAC 3 cut(s) 91, 148, 187
RsaNI GTAC 3 cut(s) 90, 147, 186
RseI CAYNNNNRTG 1 cut(s) 128
SaqAI TTAA 1 cut(s) 303
Sau96I GGNCC 1 cut(s) 158
ScaI AGTACT 1 cut(s) 187
ScrFI CCNGG 1 cut(s) 139
SduI GDGCHC 1 cut(s) 21
SetI ASST 3 cut(s) 47, 67, 273
SfaNI GCATC 2 cut(s) 87, 287
SmiMI CAYNNNNRTG 1 cut(s) 128
Sse9I AATT 2 cut(s) 37, 153
StyD4I CCNGG 1 cut(s) 137
TaaI ACNGT 2 cut(s) 23, 94
TaiI ACGT 1 cut(s) 67
TasI AATT 2 cut(s) 37, 153
TatI WGTACW 1 cut(s) 185
TfiI GAWTC 1 cut(s) 277
Tru1I TTAA 1 cut(s) 303
Tru9I TTAA 1 cut(s) 303
TscAI CASTG 2 cut(s) 26, 33
TspRI CASTG 2 cut(s) 26, 33
VneI GTGCAC 1 cut(s) 17
VspI ATTAAT 1 cut(s) 303
XapI RAATTY 1 cut(s) 37
ZrmI AGTACT 1 cut(s) 187
Zsp2I ATGCAT 1 cut(s) 302
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.