Rh3BG227700

Ubiquitin-conjugating enzyme E2, catalytic domain homologues

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Forward (+)
20942707 .. 20946919
4213 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG227700.1

Sequence Viewer

Length: 279 bp
ATGACTCTAGGCTCTGGAGGATCCGGTGTTGTGGTCCCAAGAAATTTCAGATTGCTGGAGGAACTTGAACGTGGAGAGAAAGGTATTGGGGATGGCACTGTGAGCTATGGGATGGATGATGGAGATGATATCTACATGCGTTCTTGGACTGGCACCATCATTGGTCCCCATAATGATCCTAGATATGCCATGGATGTTGGATTCAACCGGATTAACTACAAATTCACACCAGTGAATGACTGGGTCACAGCTCAGATGCCTAAACAAGAAGCAAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

92

Amino Acids

10.21

Weight (kDa)

4.75

Isoelectric Point (pI)

27.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021258)

Species Orthologous Gene IDs
pyrus_communis pycom03g10570 pycom11g14450
rosa_multiflora Rmu_co8203264.1_g000001
rosa_samantha Rh3BG227700 Rh3DG222900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 152
AclWI GGATC 3 cut(s) 15, 28, 170
AcsI RAATTY 2 cut(s) 43, 221
AgsI TTSAA 2 cut(s) 68, 205
AleI CACNNNNGTG 1 cut(s) 230
AluBI AGCT 2 cut(s) 105, 251
AluI AGCT 2 cut(s) 105, 251
AlwI GGATC 3 cut(s) 15, 28, 170
ApoI RAATTY 2 cut(s) 43, 221
AspS9I GGNCC 2 cut(s) 34, 164
AvaII GGWCC 2 cut(s) 34, 164
BamHI GGATCC 1 cut(s) 20
BanI GGYRCC 1 cut(s) 152
BccI CCATC 4 cut(s) 86, 106, 113, 164
BfaI CTAG 3 cut(s) 8, 180, 277
Bme18I GGWCC 2 cut(s) 34, 164
BmgT120I GGNCC 2 cut(s) 34, 164
BmiI GGNNCC 4 cut(s) 22, 36, 154, 166
BmrI ACTGGG 1 cut(s) 250
BmsI GCATC 1 cut(s) 246
BmuI ACTGGG 1 cut(s) 250
BpmI CTGGAG 2 cut(s) 36, 77
BsaJI CCNNGG 1 cut(s) 189
BsaWI WCCGGW 2 cut(s) 23, 207
Bse1I ACTGG 3 cut(s) 154, 230, 245
BseDI CCNNGG 1 cut(s) 189
BseGI GGATG 4 cut(s) 97, 117, 121, 199
BseMII CTCAG 1 cut(s) 266
BseNI ACTGG 3 cut(s) 154, 230, 245
BshNI GGYRCC 1 cut(s) 152
BsiSI CCGG 2 cut(s) 24, 208
BslFI GGGAC 2 cut(s) 20, 150
BsmFI GGGAC 2 cut(s) 20, 150
Bsp143I GATC 2 cut(s) 20, 175
Bsp19I CCATGG 1 cut(s) 189
BspCNI CTCAG 1 cut(s) 265
BspLI GGNNCC 4 cut(s) 22, 36, 154, 166
BspPI GGATC 3 cut(s) 15, 28, 170
BspT107I GGYRCC 1 cut(s) 152
BsrI ACTGG 3 cut(s) 154, 230, 245
BssECI CCNNGG 1 cut(s) 189
BssMI GATC 2 cut(s) 20, 175
BssT1I CCWWGG 1 cut(s) 189
Bst4CI ACNGT 1 cut(s) 100
BstDEI CTNAG 1 cut(s) 252
BstDSI CCRYGG 1 cut(s) 189
BstF5I GGATG 4 cut(s) 97, 117, 121, 199
BstKTI GATC 2 cut(s) 23, 178
BstMBI GATC 2 cut(s) 20, 175
BstMWI GCNNNNNNNGC 1 cut(s) 102
BstNSI RCATGY 1 cut(s) 139
BstX2I RGATCY 1 cut(s) 20
BstYI RGATCY 1 cut(s) 20
BtgI CCRYGG 1 cut(s) 189
BtsCI GGATG 4 cut(s) 97, 117, 121, 199
BtsIMutI CAGTG 2 cut(s) 96, 237
Cfr13I GGNCC 2 cut(s) 34, 164
CviAII CATG 2 cut(s) 136, 190
CviJI RGCY 3 cut(s) 12, 105, 251
CviKI_1 RGCY 3 cut(s) 12, 105, 251
DdeI CTNAG 1 cut(s) 252
DpnI GATC 2 cut(s) 22, 177
DpnII GATC 2 cut(s) 20, 175
Eco130I CCWWGG 1 cut(s) 189
Eco32I GATATC 1 cut(s) 130
Eco47I GGWCC 2 cut(s) 34, 164
EcoRV GATATC 1 cut(s) 130
EcoT14I CCWWGG 1 cut(s) 189
ErhI CCWWGG 1 cut(s) 189
FaeI CATG 2 cut(s) 139, 193
FaiI YATR 5 cut(s) 108, 137, 171, 186, 191
FaqI GGGAC 2 cut(s) 20, 150
FatI CATG 2 cut(s) 135, 189
FokI GGATG 4 cut(s) 104, 124, 128, 206
FspBI CTAG 3 cut(s) 8, 180, 277
GsuI CTGGAG 2 cut(s) 36, 77
HapII CCGG 2 cut(s) 24, 208
Hin1II CATG 2 cut(s) 139, 193
HinfI GANTC 2 cut(s) 4, 201
HpaII CCGG 2 cut(s) 24, 208
Hpy188I TCNGA 2 cut(s) 50, 255
Hpy188III TCNNGA 1 cut(s) 15
HpyCH4III ACNGT 1 cut(s) 100
HpyCH4IV ACGT 1 cut(s) 70
HpyF10VI GCNNNNNNNGC 1 cut(s) 102
HpyF3I CTNAG 1 cut(s) 252
HpySE526I ACGT 1 cut(s) 70
Hsp92II CATG 2 cut(s) 139, 193
Kzo9I GATC 2 cut(s) 20, 175
LpnPI CCDG 6 cut(s) 37, 41, 135, 221, 226, 243
LweI GCATC 1 cut(s) 246
MaeI CTAG 3 cut(s) 8, 180, 277
MaeII ACGT 1 cut(s) 70
MaeIII GTNAC 1 cut(s) 244
MalI GATC 2 cut(s) 22, 177
MboI GATC 2 cut(s) 20, 175
MflI RGATCY 1 cut(s) 20
MluCI AATT 2 cut(s) 43, 221
MmeI TCCRAC 1 cut(s) 178
MnlI CCTC 2 cut(s) 11, 52
MseI TTAA 1 cut(s) 213
MslI CAYNNNNRTG 1 cut(s) 230
MspI CCGG 2 cut(s) 24, 208
MwoI GCNNNNNNNGC 1 cut(s) 102
NcoI CCATGG 1 cut(s) 189
NdeII GATC 2 cut(s) 20, 175
NlaIII CATG 2 cut(s) 139, 193
NlaIV GGNNCC 4 cut(s) 22, 36, 154, 166
NmuCI GTSAC 1 cut(s) 244
NspI RCATGY 1 cut(s) 139
OliI CACNNNNGTG 1 cut(s) 230
PfeI GAWTC 1 cut(s) 201
PflFI GACNNNGTC 1 cut(s) 242
PspN4I GGNNCC 4 cut(s) 22, 36, 154, 166
PspPI GGNCC 2 cut(s) 34, 164
PsuI RGATCY 1 cut(s) 20
PsyI GACNNNGTC 1 cut(s) 242
RseI CAYNNNNRTG 1 cut(s) 230
SaqAI TTAA 1 cut(s) 213
Sau3AI GATC 2 cut(s) 20, 175
Sau96I GGNCC 2 cut(s) 34, 164
SetI ASST 4 cut(s) 73, 85, 107, 253
SfaNI GCATC 1 cut(s) 246
SinI GGWCC 2 cut(s) 34, 164
SmiMI CAYNNNNRTG 1 cut(s) 230
Sse9I AATT 2 cut(s) 43, 221
SspMI CTAG 3 cut(s) 8, 180, 277
StyI CCWWGG 1 cut(s) 189
TaaI ACNGT 1 cut(s) 100
TaiI ACGT 1 cut(s) 73
TasI AATT 2 cut(s) 43, 221
TfiI GAWTC 1 cut(s) 201
Tru1I TTAA 1 cut(s) 213
Tru9I TTAA 1 cut(s) 213
TscAI CASTG 2 cut(s) 103, 237
TseFI GTSAC 1 cut(s) 244
Tsp45I GTSAC 1 cut(s) 244
TspRI CASTG 2 cut(s) 103, 237
Tth111I GACNNNGTC 1 cut(s) 242
VpaK11BI GGWCC 2 cut(s) 34, 164
XapI RAATTY 2 cut(s) 43, 221
XceI RCATGY 1 cut(s) 139
XcmI CCANNNNNNNNNTGG 1 cut(s) 237
XspI CTAG 3 cut(s) 8, 180, 277
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.