Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8269365.1

Orthogroup ID

OG0025561

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 669

Gene Structure 668 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8269365.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 358 bp

atggaagctgaaccgctagataaatcgtcactgaccactcctcttatcgtggatgagcggcaatatgatgagccaggatgcaataccaagctagttgaagaagaactagagtccaacaattctcatcctcaaagtaaagccacaacatctactctcaaaacctgtttcaatggactcaatgctctctcaggagttgggatcctatcagttccttatgcactggcaactggagggtggtcaagcttagcacttctgtttttgttcgctgctgcagccttttactcaggcttgttaatcaagagatgtatggatatggattctagcataagaacttatcctgaaataggcgaacgcgcat

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003333 GO:0003674 GO:0005215 GO:0005342 GO:0006810 GO:0006811 GO:0006820 GO:0006865 GO:0008150 GO:0008509 GO:0008514 GO:0015075 GO:0015171 GO:0015318 GO:0015711 GO:0015849 GO:0022857 GO:0034220 GO:0046942 GO:0046943 GO:0051179 GO:0051234 GO:0055085 GO:0071702 GO:0071705 GO:0098656 GO:1903825 GO:1905039

KEGG Pathways

Metabolic & Signaling

ko04721 ko04723 ko04727 ko05032 ko05033 map04721 map04723 map04727 map05032 map05033

Pfam Domains

Protein Families

Aa_trans

Protein Analysis

119

Amino Acids

12.88

Weight (kDa)

4.64

Isoelectric Point (pI)

44.82

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025561)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_co8269365.1_g000001 Rmu_sc0003354.1_g000022
rosa_samantha	Rh2DG626200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	58
AccII	CGCG	1 cut(s)	354
AciI	CCGC	2 cut(s)	14, 58
AclWI	GGATC	2 cut(s)	193, 206
AfiI	CCNNNNNNNGG	1 cut(s)	344
AgsI	TTSAA	2 cut(s)	98, 169
AjnI	CCWGG	1 cut(s)	73
AluBI	AGCT	3 cut(s)	8, 91, 243
AluI	AGCT	3 cut(s)	8, 91, 243
AlwI	GGATC	2 cut(s)	193, 206
ApeKI	GCWGC	3 cut(s)	266, 269, 272
AspLEI	GCGC	1 cut(s)	356
BamHI	GGATCC	1 cut(s)	198
BbvI	GCAGC	3 cut(s)	253, 256, 284
BciT130I	CCWGG	1 cut(s)	75
BfaI	CTAG	4 cut(s)	17, 92, 107, 321
BfmI	CTRYAG	1 cut(s)	270
BisI	GCNGC	4 cut(s)	59, 267, 270, 273
BlpI	GCTNAGC	1 cut(s)	244
BlsI	GCNGC	4 cut(s)	60, 268, 271, 274
Bme1390I	CCNGG	1 cut(s)	75
BmiI	GGNNCC	1 cut(s)	200
BmrFI	CCNGG	1 cut(s)	75
BmsI	GCATC	1 cut(s)	68
BpmI	CTGGAG	1 cut(s)	249
Bpu1102I	GCTNAGC	1 cut(s)	244
Bsc4I	CCNNNNNNNGG	1 cut(s)	344
Bse1I	ACTGG	2 cut(s)	225, 232
BseBI	CCWGG	1 cut(s)	75
BseGI	GGATG	3 cut(s)	58, 83, 124
BseLI	CCNNNNNNNGG	1 cut(s)	344
BseMII	CTCAG	2 cut(s)	201, 297
BseNI	ACTGG	2 cut(s)	225, 232
BseRI	GAGGAG	1 cut(s)	30
BseXI	GCAGC	3 cut(s)	253, 256, 284
Bsh1236I	CGCG	1 cut(s)	354
BslI	CCNNNNNNNGG	1 cut(s)	344
Bsp143I	GATC	1 cut(s)	198
Bsp1720I	GCTNAGC	1 cut(s)	244
BspACI	CCGC	2 cut(s)	14, 58
BspCNI	CTCAG	2 cut(s)	200, 296
BspFNI	CGCG	1 cut(s)	354
BspLI	GGNNCC	1 cut(s)	200
BspMAI	CTGCAG	1 cut(s)	274
BspPI	GGATC	2 cut(s)	193, 206
BsrBI	CCGCTC	1 cut(s)	58
BsrI	ACTGG	2 cut(s)	225, 232
BssMI	GATC	1 cut(s)	198
Bst2UI	CCWGG	1 cut(s)	75
BstDEI	CTNAG	3 cut(s)	187, 244, 283
BstENI	CCTNNNNNAGG	1 cut(s)	342
BstF5I	GGATG	3 cut(s)	58, 83, 124
BstFNI	CGCG	1 cut(s)	354
BstHHI	GCGC	1 cut(s)	356
BstKTI	GATC	1 cut(s)	201
BstMBI	GATC	1 cut(s)	198
BstMWI	GCNNNNNNNGC	1 cut(s)	272
BstNI	CCWGG	1 cut(s)	75
BstSCI	CCNGG	1 cut(s)	73
BstSFI	CTRYAG	1 cut(s)	270
BstUI	CGCG	1 cut(s)	354
BstV1I	GCAGC	3 cut(s)	253, 256, 284
BstX2I	RGATCY	1 cut(s)	198
BstYI	RGATCY	1 cut(s)	198
BtsCI	GGATG	3 cut(s)	58, 83, 124
BtsIMutI	CAGTG	2 cut(s)	29, 218
CfoI	GCGC	1 cut(s)	356
CviJI	RGCY	7 cut(s)	8, 73, 91, 140, 243, 275, 288
CviKI_1	RGCY	7 cut(s)	8, 73, 91, 140, 243, 275, 288
DdeI	CTNAG	3 cut(s)	187, 244, 283
DpnI	GATC	1 cut(s)	200
DpnII	GATC	1 cut(s)	198
EcoNI	CCTNNNNNAGG	1 cut(s)	342
EcoRII	CCWGG	1 cut(s)	73
FaiI	YATR	5 cut(s)	66, 216, 308, 314, 326
Fnu4HI	GCNGC	4 cut(s)	59, 267, 270, 273
FokI	GGATG	3 cut(s)	65, 90, 111
Fsp4HI	GCNGC	4 cut(s)	59, 267, 270, 273
FspBI	CTAG	4 cut(s)	17, 92, 107, 321
GlaI	GCGC	1 cut(s)	355
GluI	GCNGC	4 cut(s)	59, 267, 270, 273
GsuI	CTGGAG	1 cut(s)	249
HhaI	GCGC	1 cut(s)	356
Hin6I	GCGC	1 cut(s)	354
HinP1I	GCGC	1 cut(s)	354
HindIII	AAGCTT	1 cut(s)	241
HinfI	GANTC	3 cut(s)	110, 174, 317
Hpy188III	TCNNGA	3 cut(s)	189, 298, 338
HpyCH4V	TGCA	3 cut(s)	81, 218, 272
HpyF10VI	GCNNNNNNNGC	1 cut(s)	272
HpyF3I	CTNAG	3 cut(s)	187, 244, 283
HspAI	GCGC	1 cut(s)	354
Kzo9I	GATC	1 cut(s)	198
LpnPI	CCDG	8 cut(s)	60, 87, 174, 175, 206, 213, 270, 351
Lsp1109I	GCAGC	3 cut(s)	253, 256, 284
LweI	GCATC	1 cut(s)	68
MaeI	CTAG	4 cut(s)	17, 92, 107, 321
MaeIII	GTNAC	1 cut(s)	27
MalI	GATC	1 cut(s)	200
MbiI	CCGCTC	1 cut(s)	58
MboI	GATC	1 cut(s)	198
MboII	GAAGA	2 cut(s)	110, 113
MflI	RGATCY	1 cut(s)	198
MluCI	AATT	1 cut(s)	118
MlyI	GAGTC	2 cut(s)	119, 168
MmeI	TCCRAC	1 cut(s)	138
MnlI	CCTC	3 cut(s)	51, 138, 224
MseI	TTAA	1 cut(s)	293
MspR9I	CCNGG	1 cut(s)	75
MvaI	CCWGG	1 cut(s)	75
MvnI	CGCG	1 cut(s)	354
MwoI	GCNNNNNNNGC	1 cut(s)	272
NdeII	GATC	1 cut(s)	198
NlaIV	GGNNCC	1 cut(s)	200
NmuCI	GTSAC	1 cut(s)	27
PfeI	GAWTC	1 cut(s)	317
PkrI	GCNGC	4 cut(s)	60, 268, 271, 274
PleI	GAGTC	2 cut(s)	118, 168
PpsI	GAGTC	2 cut(s)	118, 168
Psp6I	CCWGG	1 cut(s)	73
PspGI	CCWGG	1 cut(s)	73
PspN4I	GGNNCC	1 cut(s)	200
PstI	CTGCAG	1 cut(s)	274
PsuI	RGATCY	1 cut(s)	198
SaqAI	TTAA	1 cut(s)	293
SatI	GCNGC	4 cut(s)	59, 267, 270, 273
Sau3AI	GATC	1 cut(s)	198
SchI	GAGTC	2 cut(s)	119, 168
ScrFI	CCNGG	1 cut(s)	75
SetI	ASST	4 cut(s)	10, 93, 164, 245
SfaNI	GCATC	1 cut(s)	68
SfcI	CTRYAG	1 cut(s)	270
Sse9I	AATT	1 cut(s)	118
SsiI	CCGC	2 cut(s)	14, 58
SspMI	CTAG	4 cut(s)	17, 92, 107, 321
StyD4I	CCNGG	1 cut(s)	73
TasI	AATT	1 cut(s)	118
TauI	GCSGC	1 cut(s)	61
TfiI	GAWTC	1 cut(s)	317
Tru1I	TTAA	1 cut(s)	293
Tru9I	TTAA	1 cut(s)	293
TscAI	CASTG	2 cut(s)	36, 225
TseFI	GTSAC	1 cut(s)	27
TseI	GCWGC	3 cut(s)	266, 269, 272
Tsp45I	GTSAC	1 cut(s)	27
TspRI	CASTG	2 cut(s)	36, 225
XagI	CCTNNNNNAGG	1 cut(s)	342
XspI	CTAG	4 cut(s)	17, 92, 107, 321

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.