Rmu_co8278789.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8278789.1
Physical Location & Seq
Reverse (-)
2 .. 799
798 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8278789.1_g000001.1.cds

Sequence Viewer

Length: 703 bp
atgcttgtaaaggagattaagttgtcaaaggcaaagaggaagcaagctgaacttgaaacagaacgatggaaagtagtatctgagtctaaacatgagaggcactcattgagaagtatgttggcgaaagcgaatttgaggtttgaggttgctttaaatgaacgagtcatgaatactagtgcaacaggtacatctcatcttgggtatgaaagtcctgagtttagaaatgagtctgttgagtactctttcgaggaaaatgtcgacttagctgacatgaagcagttggaaggttgggttagctcagaggcagagaggtatgcagcagtaattgagcagaggcatcacctagaaatagatgcttttatagaacagttaagaattaaagatgagaaactagagacttacagatggcgcttgttgagcatggaaatagagtcaaagaggttagactcccatcttgagggactgaataaggatatctcacaactcagacataacaacatgaaattggaagccttgttatcagagcgagaagaagaatcaacttccctaaaagagcagtttgcatcacagttgaggtttctacattcccagatgaacaactttaggagaaaagctgaggagcaaagtcagaaaacagaaacaagtttggttgaactatctcaggaggaagacgctaagaaagaagatgaaacctcatcttata
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families
No domains found.

Protein Analysis

234

Amino Acids

27.6

Weight (kDa)

5.45

Isoelectric Point (pI)

66.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 258
AcsI RAATTY 1 cut(s) 130
AfaI GTAC 2 cut(s) 187, 239
AfiI CCNNNNNNNGG 1 cut(s) 457
AgsI TTSAA 2 cut(s) 56, 653
AhlI ACTAGT 1 cut(s) 173
AluBI AGCT 4 cut(s) 47, 266, 297, 614
AluI AGCT 4 cut(s) 47, 266, 297, 614
Alw26I GTCTC 1 cut(s) 389
ApeKI GCWGC 1 cut(s) 317
ApoI RAATTY 1 cut(s) 130
AspLEI GCGC 1 cut(s) 411
AsuHPI GGTGA 1 cut(s) 332
BbsI GAAGAC 1 cut(s) 675
BbvCI CCTCAGC 1 cut(s) 615
BbvI GCAGC 1 cut(s) 329
BccI CCATC 3 cut(s) 60, 399, 459
BcoDI GTCTC 1 cut(s) 389
BcuI ACTAGT 1 cut(s) 173
BfaI CTAG 3 cut(s) 174, 344, 392
BfoI RGCGCY 1 cut(s) 412
BisI GCNGC 1 cut(s) 318
BlsI GCNGC 1 cut(s) 319
BmcAI AGTACT 1 cut(s) 239
BmsI GCATC 3 cut(s) 343, 346, 572
BpiI GAAGAC 1 cut(s) 675
BplI GAGNNNNNCTC 2 cut(s) 86, 118
Bpu10I CCTNAGC 1 cut(s) 615
BpuEI CTTGAG 1 cut(s) 476
BsaXI ACNNNNNCTCC 2 cut(s) 5, 35
Bsc4I CCNNNNNNNGG 1 cut(s) 457
BseLI CCNNNNNNNGG 1 cut(s) 457
BseMII CTCAG 6 cut(s) 72, 204, 312, 499, 606, 674
BseRI GAGGAG 1 cut(s) 632
BseXI GCAGC 1 cut(s) 329
BslFI GGGAC 1 cut(s) 474
BslI CCNNNNNNNGG 1 cut(s) 457
BsmAI GTCTC 1 cut(s) 389
BsmFI GGGAC 1 cut(s) 474
BspCNI CTCAG 6 cut(s) 73, 205, 311, 498, 607, 673
BspHI TCATGA 1 cut(s) 165
Bst4CI ACNGT 2 cut(s) 369, 570
BstC8I GCNNGC 1 cut(s) 45
BstDEI CTNAG 8 cut(s) 81, 213, 262, 298, 485, 615, 660, 675
BstH2I RGCGCY 1 cut(s) 412
BstHHI GCGC 1 cut(s) 411
BstMAI GTCTC 1 cut(s) 389
BstMWI GCNNNNNNNGC 1 cut(s) 417
BstV1I GCAGC 1 cut(s) 329
BstV2I GAAGAC 1 cut(s) 675
Cac8I GCNNGC 1 cut(s) 45
CciI TCATGA 1 cut(s) 165
CfoI GCGC 1 cut(s) 411
CseI GACGC 1 cut(s) 680
Csp6I GTAC 2 cut(s) 186, 238
CviAII CATG 5 cut(s) 92, 166, 271, 421, 499
CviJI RGCY 5 cut(s) 47, 266, 297, 512, 614
CviKI_1 RGCY 5 cut(s) 47, 266, 297, 512, 614
CviQI GTAC 2 cut(s) 186, 238
DdeI CTNAG 8 cut(s) 81, 213, 262, 298, 485, 615, 660, 675
DraI TTTAAA 1 cut(s) 153
Eco32I GATATC 1 cut(s) 475
EcoRV GATATC 1 cut(s) 475
FaeI CATG 5 cut(s) 95, 169, 274, 424, 502
FalI AAGNNNNNCTT 2 cut(s) 36, 68
FaqI GGGAC 1 cut(s) 474
FatI CATG 5 cut(s) 91, 165, 270, 420, 498
FblI GTMKAC 1 cut(s) 258
Fnu4HI GCNGC 1 cut(s) 318
Fsp4HI GCNGC 1 cut(s) 318
FspBI CTAG 3 cut(s) 174, 344, 392
GlaI GCGC 1 cut(s) 410
GluI GCNGC 1 cut(s) 318
HaeII RGCGCY 1 cut(s) 412
HgaI GACGC 1 cut(s) 680
HhaI GCGC 1 cut(s) 411
Hin1II CATG 5 cut(s) 95, 169, 274, 424, 502
Hin6I GCGC 1 cut(s) 409
HinP1I GCGC 1 cut(s) 409
HincII GTYRAC 1 cut(s) 259
HindII GTYRAC 1 cut(s) 259
HinfI GANTC 6 cut(s) 83, 162, 227, 431, 446, 536
HphI GGTGA 1 cut(s) 332
Hpy166II GTNNAC 1 cut(s) 259
Hpy188I TCNGA 5 cut(s) 82, 301, 488, 523, 630
Hpy188III TCNNGA 4 cut(s) 166, 212, 455, 662
Hpy8I GTNNAC 1 cut(s) 259
HpyAV CCTTC 1 cut(s) 278
HpyCH4III ACNGT 2 cut(s) 369, 570
HpyCH4V TGCA 3 cut(s) 179, 317, 563
HpyF10VI GCNNNNNNNGC 1 cut(s) 417
HpyF3I CTNAG 8 cut(s) 81, 213, 262, 298, 485, 615, 660, 675
Hsp92II CATG 5 cut(s) 95, 169, 274, 424, 502
HspAI GCGC 1 cut(s) 409
LmnI GCTCC 1 cut(s) 619
LpnPI CCDG 4 cut(s) 168, 225, 602, 647
Lsp1109I GCAGC 1 cut(s) 329
LweI GCATC 3 cut(s) 343, 346, 572
MaeI CTAG 3 cut(s) 174, 344, 392
MboII GAAGA 4 cut(s) 542, 545, 680, 695
MluCI AATT 4 cut(s) 130, 324, 375, 503
MlyI GAGTC 5 cut(s) 92, 171, 236, 440, 440
MmeI TCCRAC 1 cut(s) 261
MseI TTAA 4 cut(s) 18, 152, 371, 378
MwoI GCNNNNNNNGC 1 cut(s) 417
NlaIII CATG 5 cut(s) 95, 169, 274, 424, 502
PagI TCATGA 1 cut(s) 165
PfeI GAWTC 1 cut(s) 536
PkrI GCNGC 1 cut(s) 319
PleI GAGTC 5 cut(s) 91, 170, 235, 439, 440
PpsI GAGTC 5 cut(s) 91, 170, 235, 439, 440
RsaI GTAC 2 cut(s) 187, 239
RsaNI GTAC 2 cut(s) 186, 238
SalI GTCGAC 1 cut(s) 257
SaqAI TTAA 4 cut(s) 18, 152, 371, 378
SatI GCNGC 1 cut(s) 318
ScaI AGTACT 1 cut(s) 239
SchI GAGTC 5 cut(s) 92, 171, 236, 440, 440
SfaNI GCATC 3 cut(s) 343, 346, 572
SmlI CTYRAG 1 cut(s) 455
SmoI CTYRAG 1 cut(s) 455
SpeI ACTAGT 1 cut(s) 173
Sse9I AATT 4 cut(s) 130, 324, 375, 503
SspMI CTAG 3 cut(s) 174, 344, 392
TaaI ACNGT 2 cut(s) 369, 570
TaqI TCGA 2 cut(s) 246, 258
TasI AATT 4 cut(s) 130, 324, 375, 503
TatI WGTACW 1 cut(s) 237
TfiI GAWTC 1 cut(s) 536
Tru1I TTAA 4 cut(s) 18, 152, 371, 378
Tru9I TTAA 4 cut(s) 18, 152, 371, 378
TseI GCWGC 1 cut(s) 317
TspDTI ATGAA 7 cut(s) 171, 182, 219, 287, 515, 608, 702
XapI RAATTY 1 cut(s) 130
XmiI GTMKAC 1 cut(s) 258
XspI CTAG 3 cut(s) 174, 344, 392
ZrmI AGTACT 1 cut(s) 239
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.