Rmu_co8359369.1_g000001

Ctr copper transporter family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8359369.1
Physical Location & Seq
Forward (+)
513 .. 908
396 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8359369.1_g000001.1.cds

Sequence Viewer

Length: 396 bp
atgaaaacccatttcacatttttcaggggcaaaaacaccacagcaattatattcccgggatggcccggagagagccttgaatcctacatcttagccttaatagctgtctttctgctctctttggtggttgagtggctttctcacgctagattgatcgagcctagttcggataataatatcgctgatggacttcgacagaccttgatgtatggtaccagagtcggactgtcttatttggtaatgcttgcagtcatgtcattcgatgttggtgttctactagctgcaattgcaggatgttcagttgggttcctggtgtttggtagtagggtttttatgagatcgaaggtagggcatagtaatatggatcaaactgatcttcctccattgaaatgctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

131

Amino Acids

14.39

Weight (kDa)

7.83

Isoelectric Point (pI)

35.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017749)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 212
AccB1I GGYRCC 1 cut(s) 212
AclWI GGATC 1 cut(s) 372
AfaI GTAC 1 cut(s) 214
AgsI TTSAA 2 cut(s) 80, 388
AjnI CCWGG 1 cut(s) 309
AluBI AGCT 2 cut(s) 104, 281
AluI AGCT 2 cut(s) 104, 281
AlwI GGATC 1 cut(s) 372
Ama87I CYCGRG 1 cut(s) 55
AoxI GGCC 1 cut(s) 62
ApeKI GCWGC 1 cut(s) 281
Asp718I GGTACC 1 cut(s) 212
AspS9I GGNCC 1 cut(s) 63
AsuC2I CCSGG 3 cut(s) 56, 57, 66
AvaI CYCGRG 1 cut(s) 55
BaeI ACNNNNGTAYC 2 cut(s) 204, 237
BanI GGYRCC 1 cut(s) 212
BbvI GCAGC 1 cut(s) 268
BccI CCATC 2 cut(s) 54, 179
BciT130I CCWGG 1 cut(s) 311
BcnI CCSGG 3 cut(s) 56, 57, 66
BfaI CTAG 3 cut(s) 147, 162, 278
BisI GCNGC 1 cut(s) 282
BlsI GCNGC 1 cut(s) 283
Bme1390I CCNGG 4 cut(s) 56, 57, 66, 311
BmeT110I CYCGRG 1 cut(s) 55
BmgT120I GGNCC 1 cut(s) 63
BmiI GGNNCC 2 cut(s) 214, 308
BmrFI CCNGG 4 cut(s) 56, 57, 66, 311
BpuMI CCSGG 3 cut(s) 56, 57, 66
BsaJI CCNNGG 1 cut(s) 55
BseBI CCWGG 1 cut(s) 311
BseDI CCNNGG 1 cut(s) 55
BseGI GGATG 2 cut(s) 65, 299
BseXI GCAGC 1 cut(s) 268
BshFI GGCC 1 cut(s) 64
BshNI GGYRCC 1 cut(s) 212
BsiHKCI CYCGRG 1 cut(s) 55
BsiSI CCGG 2 cut(s) 56, 66
BsnI GGCC 1 cut(s) 64
BsoBI CYCGRG 1 cut(s) 55
Bsp143I GATC 4 cut(s) 153, 338, 364, 373
BspANI GGCC 1 cut(s) 64
BspLI GGNNCC 2 cut(s) 214, 308
BspPI GGATC 1 cut(s) 372
BspT107I GGYRCC 1 cut(s) 212
BssECI CCNNGG 1 cut(s) 55
BssMI GATC 4 cut(s) 153, 338, 364, 373
Bst2UI CCWGG 1 cut(s) 311
Bst4CI ACNGT 1 cut(s) 228
BstC8I GCNNGC 1 cut(s) 246
BstDEI CTNAG 1 cut(s) 91
BstF5I GGATG 2 cut(s) 65, 299
BstKTI GATC 4 cut(s) 156, 341, 367, 376
BstMBI GATC 4 cut(s) 153, 338, 364, 373
BstMWI GCNNNNNNNGC 2 cut(s) 101, 287
BstNI CCWGG 1 cut(s) 311
BstSCI CCNGG 4 cut(s) 54, 55, 64, 309
BstV1I GCAGC 1 cut(s) 268
BsuRI GGCC 1 cut(s) 64
BtsCI GGATG 2 cut(s) 65, 299
Cac8I GCNNGC 1 cut(s) 246
Cfr13I GGNCC 1 cut(s) 63
Cfr9I CCCGGG 1 cut(s) 55
Csp6I GTAC 1 cut(s) 213
CviAII CATG 1 cut(s) 253
CviJI RGCY 7 cut(s) 64, 75, 95, 104, 136, 160, 281
CviKI_1 RGCY 7 cut(s) 64, 75, 95, 104, 136, 160, 281
CviQI GTAC 1 cut(s) 213
DdeI CTNAG 1 cut(s) 91
DpnI GATC 4 cut(s) 155, 340, 366, 375
DpnII GATC 4 cut(s) 153, 338, 364, 373
Eco88I CYCGRG 1 cut(s) 55
EcoRII CCWGG 1 cut(s) 309
FaeI CATG 1 cut(s) 256
FaiI YATR 6 cut(s) 50, 210, 254, 335, 354, 362
FatI CATG 1 cut(s) 252
Fnu4HI GCNGC 1 cut(s) 282
FokI GGATG 2 cut(s) 72, 306
Fsp4HI GCNGC 1 cut(s) 282
FspBI CTAG 3 cut(s) 147, 162, 278
GluI GCNGC 1 cut(s) 282
HaeIII GGCC 1 cut(s) 64
HapII CCGG 2 cut(s) 56, 66
Hin1II CATG 1 cut(s) 256
HinfI GANTC 2 cut(s) 80, 219
HpaII CCGG 2 cut(s) 56, 66
Hpy188I TCNGA 2 cut(s) 169, 224
HpyAV CCTTC 1 cut(s) 337
HpyCH4III ACNGT 1 cut(s) 228
HpyCH4V TGCA 3 cut(s) 248, 284, 290
HpyF10VI GCNNNNNNNGC 2 cut(s) 101, 287
HpyF3I CTNAG 1 cut(s) 91
Hsp92II CATG 1 cut(s) 256
KpnI GGTACC 1 cut(s) 216
Kzo9I GATC 4 cut(s) 153, 338, 364, 373
LpnPI CCDG 7 cut(s) 10, 69, 79, 229, 276, 296, 323
Lsp1109I GCAGC 1 cut(s) 268
MaeI CTAG 3 cut(s) 147, 162, 278
MalI GATC 4 cut(s) 155, 340, 366, 375
MboI GATC 4 cut(s) 153, 338, 364, 373
MboII GAAGA 1 cut(s) 368
MfeI CAATTG 1 cut(s) 285
MluCI AATT 2 cut(s) 45, 285
MlyI GAGTC 1 cut(s) 228
MmeI TCCRAC 1 cut(s) 202
MnlI CCTC 1 cut(s) 390
MseI TTAA 1 cut(s) 98
MslI CAYNNNNRTG 1 cut(s) 388
MspI CCGG 2 cut(s) 56, 66
MspR9I CCNGG 4 cut(s) 56, 57, 66, 311
MunI CAATTG 1 cut(s) 285
MvaI CCWGG 1 cut(s) 311
MwoI GCNNNNNNNGC 2 cut(s) 101, 287
NciI CCSGG 3 cut(s) 56, 57, 66
NdeII GATC 4 cut(s) 153, 338, 364, 373
NlaIII CATG 1 cut(s) 256
NlaIV GGNNCC 2 cut(s) 214, 308
PfeI GAWTC 1 cut(s) 80
PkrI GCNGC 1 cut(s) 283
PleI GAGTC 1 cut(s) 227
PpsI GAGTC 1 cut(s) 227
Psp6I CCWGG 1 cut(s) 309
PspGI CCWGG 1 cut(s) 309
PspN4I GGNNCC 2 cut(s) 214, 308
PspPI GGNCC 1 cut(s) 63
RsaI GTAC 1 cut(s) 214
RsaNI GTAC 1 cut(s) 213
RseI CAYNNNNRTG 1 cut(s) 388
SaqAI TTAA 1 cut(s) 98
SatI GCNGC 1 cut(s) 282
Sau3AI GATC 4 cut(s) 153, 338, 364, 373
Sau96I GGNCC 1 cut(s) 63
SchI GAGTC 1 cut(s) 228
ScrFI CCNGG 4 cut(s) 56, 57, 66, 311
SetI ASST 4 cut(s) 106, 203, 283, 348
SmaI CCCGGG 1 cut(s) 57
SmiMI CAYNNNNRTG 1 cut(s) 388
Sse9I AATT 2 cut(s) 45, 285
SspMI CTAG 3 cut(s) 147, 162, 278
StyD4I CCNGG 4 cut(s) 54, 55, 64, 309
TaaI ACNGT 1 cut(s) 228
TaqI TCGA 4 cut(s) 156, 193, 261, 341
TasI AATT 2 cut(s) 45, 285
TfiI GAWTC 1 cut(s) 80
Tru1I TTAA 1 cut(s) 98
Tru9I TTAA 1 cut(s) 98
TseI GCWGC 1 cut(s) 281
TspDTI ATGAA 1 cut(s) 17
TspMI CCCGGG 1 cut(s) 55
XmaI CCCGGG 1 cut(s) 55
XspI CTAG 3 cut(s) 147, 162, 278
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.