Rmu_co8488167.1_g000002

Nodulin-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8488167.1
OG0023059
Physical Location & Seq
Reverse (-)
1613 .. 2101
489 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8488167.1_g000002.1.cds

Sequence Viewer

Length: 489 bp
atggctgtggcacaactcataatggcagttgggcatctcttcattgcttttggatggcctggggcaatgcacattgctaccatcttgattgggctaggctatggggctcattgggcaattgtgccagctgctgcctctgaattgtttggcttgaaaaagtttggggctttatacaatttcctcacactggcaaaccctgctggtagtttagtcttttctggtctgattgctagcagtatatatgaccgtgaagcagagaagcaagctcatcagcctcatctcgtgcatcagattccaggatcaattttccaagggattcctggacaggatgcaccgaagtgtcatggtgcgatatgcttcttcttaacttcggtaataatgtccgtattctgtgttattgcatttcttttgagcatgattctggtacgtaggactaagattgtatataccaatctctatggaaagtcccgttcatctgggctttcataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Nodulin-like

Protein Analysis

162

Amino Acids

17.36

Weight (kDa)

9.33

Isoelectric Point (pI)

32.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0023059)

Species Orthologous Gene IDs
rosa_multiflora Rmu_co8488167.1_g000002 Rmu_co8515361.1_g000001 Rmu_sc0000998.1_g000006 Rmu_sc0003558.1_g000008

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 307
AfaI GTAC 1 cut(s) 426
AfiI CCNNNNNNNGG 1 cut(s) 187
AgsI TTSAA 1 cut(s) 154
AjnI CCWGG 3 cut(s) 58, 295, 319
AleI CACNNNNGTG 1 cut(s) 337
AluBI AGCT 2 cut(s) 128, 266
AluI AGCT 2 cut(s) 128, 266
AlwI GGATC 1 cut(s) 307
AlwNI CAGNNNCTG 1 cut(s) 131
AoxI GGCC 1 cut(s) 56
ApeKI GCWGC 2 cut(s) 128, 131
AsuNHI GCTAGC 1 cut(s) 230
BanII GRGCYC 1 cut(s) 109
BauI CACGAG 1 cut(s) 281
BbvI GCAGC 2 cut(s) 115, 118
BccI CCATC 2 cut(s) 48, 89
BciT130I CCWGG 3 cut(s) 60, 297, 321
BfaI CTAG 2 cut(s) 95, 231
BisI GCNGC 2 cut(s) 129, 132
BlsI GCNGC 2 cut(s) 130, 133
Bme1390I CCNGG 3 cut(s) 60, 297, 321
BmrFI CCNGG 3 cut(s) 60, 297, 321
BmsI GCATC 3 cut(s) 43, 295, 319
BmtI GCTAGC 1 cut(s) 234
BsaAI YACGTR 1 cut(s) 428
BsaJI CCNNGG 2 cut(s) 59, 310
Bsc4I CCNNNNNNNGG 1 cut(s) 187
Bse1I ACTGG 1 cut(s) 192
Bse3DI GCAATG 3 cut(s) 42, 72, 72
BseBI CCWGG 3 cut(s) 60, 297, 321
BseDI CCNNGG 2 cut(s) 59, 310
BseGI GGATG 2 cut(s) 59, 334
BseLI CCNNNNNNNGG 1 cut(s) 187
BseMI GCAATG 3 cut(s) 42, 72, 72
BseNI ACTGG 1 cut(s) 192
BseXI GCAGC 2 cut(s) 115, 118
BshFI GGCC 1 cut(s) 58
BslFI GGGAC 1 cut(s) 451
BslI CCNNNNNNNGG 1 cut(s) 187
BsmFI GGGAC 1 cut(s) 451
BsnI GGCC 1 cut(s) 58
Bsp1286I GDGCHC 1 cut(s) 109
Bsp143I GATC 1 cut(s) 299
BspANI GGCC 1 cut(s) 58
BspOI GCTAGC 1 cut(s) 234
BspPI GGATC 1 cut(s) 307
BsrDI GCAATG 3 cut(s) 42, 72, 72
BsrI ACTGG 1 cut(s) 192
BssECI CCNNGG 2 cut(s) 59, 310
BssMI GATC 1 cut(s) 299
BssSI CACGAG 1 cut(s) 281
BssT1I CCWWGG 1 cut(s) 310
Bst2BI CACGAG 1 cut(s) 281
Bst2UI CCWGG 3 cut(s) 60, 297, 321
Bst4CI ACNGT 1 cut(s) 248
Bst6I CTCTTC 1 cut(s) 44
BstAPI GCANNNNNTGC 1 cut(s) 197
BstBAI YACGTR 1 cut(s) 428
BstC8I GCNNGC 3 cut(s) 126, 232, 264
BstDEI CTNAG 1 cut(s) 435
BstF5I GGATG 2 cut(s) 59, 334
BstKTI GATC 1 cut(s) 302
BstMBI GATC 1 cut(s) 299
BstMWI GCNNNNNNNGC 2 cut(s) 113, 197
BstNI CCWGG 3 cut(s) 60, 297, 321
BstSCI CCNGG 3 cut(s) 58, 295, 319
BstSNI TACGTA 1 cut(s) 428
BstV1I GCAGC 2 cut(s) 115, 118
BsuRI GGCC 1 cut(s) 58
BtsCI GGATG 2 cut(s) 59, 334
BtsIMutI CAGTG 1 cut(s) 185
Cac8I GCNNGC 3 cut(s) 126, 232, 264
CaiI CAGNNNCTG 1 cut(s) 131
Csp6I GTAC 1 cut(s) 425
CviAII CATG 2 cut(s) 344, 415
CviQI GTAC 1 cut(s) 425
DdeI CTNAG 1 cut(s) 435
DpnI GATC 1 cut(s) 301
DpnII GATC 1 cut(s) 299
Eam1104I CTCTTC 1 cut(s) 44
EarI CTCTTC 1 cut(s) 44
Eco105I TACGTA 1 cut(s) 428
Eco130I CCWWGG 1 cut(s) 310
Eco24I GRGCYC 1 cut(s) 109
EcoRII CCWGG 3 cut(s) 58, 295, 319
EcoT14I CCWWGG 1 cut(s) 310
EcoT38I GRGCYC 1 cut(s) 109
ErhI CCWWGG 1 cut(s) 310
FaeI CATG 2 cut(s) 347, 418
FaqI GGGAC 1 cut(s) 451
FatI CATG 2 cut(s) 343, 414
Fnu4HI GCNGC 2 cut(s) 129, 132
FokI GGATG 2 cut(s) 66, 341
FriOI GRGCYC 1 cut(s) 109
Fsp4HI GCNGC 2 cut(s) 129, 132
FspBI CTAG 2 cut(s) 95, 231
GluI GCNGC 2 cut(s) 129, 132
HaeIII GGCC 1 cut(s) 58
Hin1II CATG 2 cut(s) 347, 418
HinfI GANTC 3 cut(s) 292, 316, 418
Hpy188I TCNGA 3 cut(s) 139, 225, 291
Hpy188III TCNNGA 1 cut(s) 85
HpyCH4III ACNGT 1 cut(s) 248
HpyCH4IV ACGT 1 cut(s) 427
HpyCH4V TGCA 4 cut(s) 70, 286, 332, 401
HpyF10VI GCNNNNNNNGC 2 cut(s) 113, 197
HpyF3I CTNAG 1 cut(s) 435
HpySE526I ACGT 1 cut(s) 427
Hsp92II CATG 2 cut(s) 347, 418
Kzo9I GATC 1 cut(s) 299
Lsp1109I GCAGC 2 cut(s) 115, 118
LweI GCATC 3 cut(s) 43, 295, 319
MaeI CTAG 2 cut(s) 95, 231
MaeII ACGT 1 cut(s) 427
MalI GATC 1 cut(s) 301
MboI GATC 1 cut(s) 299
MboII GAAGA 2 cut(s) 31, 352
MfeI CAATTG 1 cut(s) 117
MhlI GDGCHC 1 cut(s) 109
MluCI AATT 4 cut(s) 117, 140, 175, 303
MnlI CCTC 3 cut(s) 145, 191, 285
MseI TTAA 1 cut(s) 365
MslI CAYNNNNRTG 1 cut(s) 337
MspA1I CMGCKG 1 cut(s) 128
MspR9I CCNGG 3 cut(s) 60, 297, 321
MunI CAATTG 1 cut(s) 117
MvaI CCWGG 3 cut(s) 60, 297, 321
MwoI GCNNNNNNNGC 2 cut(s) 113, 197
NdeII GATC 1 cut(s) 299
NheI GCTAGC 1 cut(s) 230
NlaIII CATG 2 cut(s) 347, 418
OliI CACNNNNGTG 1 cut(s) 337
PfeI GAWTC 3 cut(s) 292, 316, 418
PfoI TCCNGGA 2 cut(s) 295, 319
PkrI GCNGC 2 cut(s) 130, 133
Ppu21I YACGTR 1 cut(s) 428
Psp6I CCWGG 3 cut(s) 58, 295, 319
PspGI CCWGG 3 cut(s) 58, 295, 319
PstNI CAGNNNCTG 1 cut(s) 131
PvuII CAGCTG 1 cut(s) 128
RsaI GTAC 1 cut(s) 426
RsaNI GTAC 1 cut(s) 425
RseI CAYNNNNRTG 1 cut(s) 337
SaqAI TTAA 1 cut(s) 365
SatI GCNGC 2 cut(s) 129, 132
Sau3AI GATC 1 cut(s) 299
ScrFI CCNGG 3 cut(s) 60, 297, 321
SduI GDGCHC 1 cut(s) 109
SetI ASST 3 cut(s) 130, 268, 430
SfaNI GCATC 3 cut(s) 43, 295, 319
SmiMI CAYNNNNRTG 1 cut(s) 337
SnaBI TACGTA 1 cut(s) 428
Sse9I AATT 4 cut(s) 117, 140, 175, 303
SspMI CTAG 2 cut(s) 95, 231
StyD4I CCNGG 3 cut(s) 58, 295, 319
StyI CCWWGG 1 cut(s) 310
TaaI ACNGT 1 cut(s) 248
TaiI ACGT 1 cut(s) 430
TasI AATT 4 cut(s) 117, 140, 175, 303
TfiI GAWTC 3 cut(s) 292, 316, 418
Tru1I TTAA 1 cut(s) 365
Tru9I TTAA 1 cut(s) 365
TscAI CASTG 1 cut(s) 192
TseI GCWGC 2 cut(s) 128, 131
TspDTI ATGAA 3 cut(s) 31, 462, 474
TspGWI ACGGA 1 cut(s) 373
TspRI CASTG 1 cut(s) 192
XcmI CCANNNNNNNNNTGG 1 cut(s) 317
XspI CTAG 2 cut(s) 95, 231
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.