Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000185.1

Orthogroup ID

OG0021625

Physical Location & Seq

Genomic Coordinates Reverse (-)

57999 .. 58382

Gene Structure 384 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 384 bp

ctgcaagtggctgagaggcatactgaggttcttttgagcaacaatgccaggcccattgggacaaagaaaattcctgaggataattatggcaaagtcaaaggtggaaagaaccccaatgaaaagagggttggacgtgctgatccctacccacgtggcaacaatgcaccacgtggcaagggacgtgggggtagtggtatgggctgtggaggccctcccaatgtatggcgcagagatggtggtgctggccctagtggtcatggaaacaaggtgcaaatggcacttaagaaccttcagtcaaacagggtaaagttggcaatgaaccatgctataggtgtggagtcatggggcattggtacaagaactgtcaagcaagcaacagagtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Retrotran_gag_2 zf-CCHC

Protein Analysis

127

Amino Acids

13.49

Weight (kDa)

10.64

Isoelectric Point (pI)

30.32

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021625)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_co7989702.1_g000001 Rmu_sc0000185.1_g000014
rosa_roxburghii	Rroxscaffold_1G00011930 Rroxscaffold_5G00377720 Rroxscaffold_6G00395160

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	222
AclWI	GGATC	1 cut(s)	134
AcsI	RAATTY	1 cut(s)	69
AcuI	CTGAAG	1 cut(s)	275
AcvI	CACGTG	2 cut(s)	152, 170
AdeI	CACNNNGTG	1 cut(s)	170
AfaI	GTAC	1 cut(s)	355
AfiI	CCNNNNNNNGG	1 cut(s)	222
AflII	CTTAAG	1 cut(s)	281
AjiI	CACGTC	2 cut(s)	134, 182
AjnI	CCWGG	1 cut(s)	47
AjuI	GAANNNNNNNTTGG	2 cut(s)	111, 143
AlwI	GGATC	1 cut(s)	134
AoxI	GGCC	3 cut(s)	50, 208, 244
ApoI	RAATTY	1 cut(s)	69
AspLEI	GCGC	1 cut(s)	228
AspS9I	GGNCC	3 cut(s)	51, 209, 245
AxyI	CCTNAGG	1 cut(s)	75
BbrPI	CACGTG	2 cut(s)	152, 170
BccI	CCATC	1 cut(s)	227
BciT130I	CCWGG	1 cut(s)	49
BfaI	CTAG	1 cut(s)	249
BfmI	CTRYAG	1 cut(s)	327
BfrI	CTTAAG	1 cut(s)	281
Bme1390I	CCNGG	1 cut(s)	49
BmgBI	CACGTC	2 cut(s)	134, 182
BmgT120I	GGNCC	3 cut(s)	51, 209, 245
BmrFI	CCNGG	1 cut(s)	49
BsaAI	YACGTR	2 cut(s)	152, 170
Bsc4I	CCNNNNNNNGG	1 cut(s)	222
Bse21I	CCTNAGG	1 cut(s)	75
Bse3DI	GCAATG	1 cut(s)	321
BseBI	CCWGG	1 cut(s)	49
BseLI	CCNNNNNNNGG	1 cut(s)	222
BseMI	GCAATG	1 cut(s)	321
BseMII	CTCAG	2 cut(s)	15, 66
BshFI	GGCC	3 cut(s)	52, 210, 246
BslFI	GGGAC	2 cut(s)	73, 192
BslI	CCNNNNNNNGG	1 cut(s)	222
BsmFI	GGGAC	2 cut(s)	73, 192
BsnI	GGCC	3 cut(s)	52, 210, 246
Bsp143I	GATC	1 cut(s)	139
BspANI	GGCC	3 cut(s)	52, 210, 246
BspCNI	CTCAG	3 cut(s)	4, 16, 67
BspPI	GGATC	1 cut(s)	134
BspTI	CTTAAG	1 cut(s)	281
BsrDI	GCAATG	1 cut(s)	321
BssMI	GATC	1 cut(s)	139
Bst2UI	CCWGG	1 cut(s)	49
Bst4CI	ACNGT	1 cut(s)	364
BstAFI	CTTAAG	1 cut(s)	281
BstBAI	YACGTR	2 cut(s)	152, 170
BstC8I	GCNNGC	2 cut(s)	244, 372
BstDEI	CTNAG	3 cut(s)	12, 24, 75
BstHHI	GCGC	1 cut(s)	228
BstKTI	GATC	1 cut(s)	142
BstMBI	GATC	1 cut(s)	139
BstMWI	GCNNNNNNNGC	1 cut(s)	207
BstNI	CCWGG	1 cut(s)	49
BstSCI	CCNGG	1 cut(s)	47
BstSFI	CTRYAG	1 cut(s)	327
Bsu36I	CCTNAGG	1 cut(s)	75
BsuRI	GGCC	3 cut(s)	52, 210, 246
BtrI	CACGTC	2 cut(s)	134, 182
Cac8I	GCNNGC	2 cut(s)	244, 372
CfoI	GCGC	1 cut(s)	228
Cfr13I	GGNCC	3 cut(s)	51, 209, 245
Csp6I	GTAC	1 cut(s)	354
CspCI	CAANNNNNGTGG	2 cut(s)	163, 198
CviAII	CATG	3 cut(s)	257, 323, 342
CviJI	RGCY	5 cut(s)	11, 52, 201, 210, 246
CviKI_1	RGCY	5 cut(s)	11, 52, 201, 210, 246
CviQI	GTAC	1 cut(s)	354
DdeI	CTNAG	3 cut(s)	12, 24, 75
DpnI	GATC	1 cut(s)	141
DpnII	GATC	1 cut(s)	139
DraIII	CACNNNGTG	1 cut(s)	170
Eco57I	CTGAAG	1 cut(s)	275
Eco72I	CACGTG	2 cut(s)	152, 170
Eco81I	CCTNAGG	1 cut(s)	75
EcoO109I	RGGNCCY	1 cut(s)	209
EcoRII	CCWGG	1 cut(s)	47
FaeI	CATG	3 cut(s)	260, 326, 345
FaiI	YATR	8 cut(s)	21, 87, 197, 223, 258, 324, 329, 343
FaqI	GGGAC	2 cut(s)	73, 192
FatI	CATG	3 cut(s)	256, 322, 341
FspBI	CTAG	1 cut(s)	249
GlaI	GCGC	1 cut(s)	227
HaeIII	GGCC	3 cut(s)	52, 210, 246
HhaI	GCGC	1 cut(s)	228
Hin1II	CATG	3 cut(s)	260, 326, 345
Hin6I	GCGC	1 cut(s)	226
HinP1I	GCGC	1 cut(s)	226
HinfI	GANTC	1 cut(s)	338
Hpy188III	TCNNGA	1 cut(s)	74
HpyAV	CCTTC	1 cut(s)	299
HpyCH4III	ACNGT	1 cut(s)	364
HpyCH4IV	ACGT	4 cut(s)	133, 151, 169, 181
HpyCH4V	TGCA	3 cut(s)	4, 164, 271
HpyF10VI	GCNNNNNNNGC	1 cut(s)	207
HpyF3I	CTNAG	3 cut(s)	12, 24, 75
HpySE526I	ACGT	4 cut(s)	133, 151, 169, 181
Hsp92II	CATG	3 cut(s)	260, 326, 345
HspAI	GCGC	1 cut(s)	226
Kzo9I	GATC	1 cut(s)	139
LpnPI	CCDG	5 cut(s)	34, 61, 87, 228, 286
MaeI	CTAG	1 cut(s)	249
MaeII	ACGT	4 cut(s)	133, 151, 169, 181
MalI	GATC	1 cut(s)	141
MboI	GATC	1 cut(s)	139
MluCI	AATT	2 cut(s)	69, 82
MlyI	GAGTC	1 cut(s)	347
MmeI	TCCRAC	1 cut(s)	109
MnlI	CCTC	6 cut(s)	9, 19, 70, 117, 200, 222
MseI	TTAA	1 cut(s)	282
MspCI	CTTAAG	1 cut(s)	281
MspR9I	CCNGG	1 cut(s)	49
MvaI	CCWGG	1 cut(s)	49
MwoI	GCNNNNNNNGC	1 cut(s)	207
NdeII	GATC	1 cut(s)	139
NlaIII	CATG	3 cut(s)	260, 326, 345
PflMI	CCANNNNNTGG	1 cut(s)	222
PleI	GAGTC	1 cut(s)	346
PmaCI	CACGTG	2 cut(s)	152, 170
PmlI	CACGTG	2 cut(s)	152, 170
PpsI	GAGTC	1 cut(s)	346
Ppu21I	YACGTR	2 cut(s)	152, 170
Psp6I	CCWGG	1 cut(s)	47
PspCI	CACGTG	2 cut(s)	152, 170
PspGI	CCWGG	1 cut(s)	47
PspPI	GGNCC	3 cut(s)	51, 209, 245
RsaI	GTAC	1 cut(s)	355
RsaNI	GTAC	1 cut(s)	354
SaqAI	TTAA	1 cut(s)	282
Sau3AI	GATC	1 cut(s)	139
Sau96I	GGNCC	3 cut(s)	51, 209, 245
SchI	GAGTC	1 cut(s)	347
ScrFI	CCNGG	1 cut(s)	49
SetI	ASST	9 cut(s)	30, 103, 136, 154, 172, 184, 270, 291, 334
SfcI	CTRYAG	1 cut(s)	327
SmlI	CTYRAG	1 cut(s)	281
SmoI	CTYRAG	1 cut(s)	281
Sse9I	AATT	2 cut(s)	69, 82
SspMI	CTAG	1 cut(s)	249
StyD4I	CCNGG	1 cut(s)	47
TaaI	ACNGT	1 cut(s)	364
TaiI	ACGT	4 cut(s)	136, 154, 172, 184
TasI	AATT	2 cut(s)	69, 82
Tru1I	TTAA	1 cut(s)	282
Tru9I	TTAA	1 cut(s)	282
TspDTI	ATGAA	2 cut(s)	132, 332
Van91I	CCANNNNNTGG	1 cut(s)	222
Vha464I	CTTAAG	1 cut(s)	281
XapI	RAATTY	1 cut(s)	69
XspI	CTAG	1 cut(s)	249

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.