Rmu_sc0000244.1_g000002

Protein phosphatase 1 regulatory subunit

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000244.1
OG0025476
Physical Location & Seq
Reverse (-)
22813 .. 23711
899 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000244.1_g000002.1.cds

Sequence Viewer

Length: 591 bp
atgccaatgggaggtgttgagcatgggatattgcacgatttgcgaatcgcagcttttagccttcctcttggtctttggtggtctgggaggacgagcacgacggagtcgacctccccattagcagccaggtataatcatgatgatccgacagccgagaacgacggaaatccttcctccaccgtcctcgatctcaccagcttccaactccacgacctcgactcggtcgagctaccactaagtctcaccgagttagacctcacggccaaccgcctctcctccttggacactcgcattggaacactctccaacctcaccaagctctccttcctccataacctcatcgacaacgccgccgtccaaccgttctccgcttggactgccctctctagcctcgaggttcctcctcaatcaaatcgttttggaatcaaattgaatttgattgtacaggagttggtgttgagggataataagctgaataaaattccaaatgtgagcatcttcaagaagcttctggttttcgacgtacctcaggttggtgtctttgaattgggaattagggatttgagtcgtaggttttggtgtggaagctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRR_4 LRR_6 LRR_8

Protein Analysis

196

Amino Acids

21.66

Weight (kDa)

5.46

Isoelectric Point (pI)

37.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025476)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0000244.1_g000002
rosa_samantha Rh1BG165900 Rh1DG196500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AbsI CCTCGAGG 1 cut(s) 392
AccI GTMKAC 1 cut(s) 107
AciI CCGC 3 cut(s) 268, 351, 369
AclWI GGATC 1 cut(s) 137
AcoI YGGCCR 1 cut(s) 261
AcsI RAATTY 2 cut(s) 433, 480
AfaI GTAC 2 cut(s) 444, 525
AfiI CCNNNNNNNGG 3 cut(s) 11, 220, 533
AgsI TTSAA 3 cut(s) 433, 502, 545
AjnI CCWGG 1 cut(s) 125
AjuI GAANNNNNNNTTGG 2 cut(s) 308, 340
AluBI AGCT 7 cut(s) 53, 198, 229, 319, 472, 508, 588
AluI AGCT 7 cut(s) 53, 198, 229, 319, 472, 508, 588
Alw21I GWGCWC 1 cut(s) 98
Alw26I GTCTC 1 cut(s) 245
AlwI GGATC 1 cut(s) 137
Ama87I CYCGRG 1 cut(s) 392
AoxI GGCC 1 cut(s) 261
ApeKI GCWGC 2 cut(s) 50, 122
ApoI RAATTY 2 cut(s) 433, 480
Asp700I GAANNNNTTC 1 cut(s) 169
AsuHPI GGTGA 3 cut(s) 184, 235, 304
AvaI CYCGRG 1 cut(s) 392
AxyI CCTNAGG 1 cut(s) 528
Bbv12I GWGCWC 1 cut(s) 98
BbvI GCAGC 2 cut(s) 62, 134
BceAI ACGGC 2 cut(s) 276, 338
BciT130I CCWGG 1 cut(s) 127
BcoDI GTCTC 1 cut(s) 245
BfaI CTAG 1 cut(s) 387
BisI GCNGC 3 cut(s) 51, 123, 351
BlsI GCNGC 3 cut(s) 52, 124, 352
Bme1390I CCNGG 1 cut(s) 127
BmeT110I CYCGRG 1 cut(s) 392
BmiI GGNNCC 1 cut(s) 399
BmrFI CCNGG 1 cut(s) 127
BmsI GCATC 1 cut(s) 504
BplI GAGNNNNNCTC 2 cut(s) 95, 127
BsaJI CCNNGG 1 cut(s) 279
BsaXI ACNNNNNCTCC 4 cut(s) 257, 287, 440, 470
Bsc4I CCNNNNNNNGG 3 cut(s) 11, 220, 533
Bse21I CCTNAGG 1 cut(s) 528
BseBI CCWGG 1 cut(s) 127
BseDI CCNNGG 1 cut(s) 279
BseLI CCNNNNNNNGG 3 cut(s) 11, 220, 533
BseMII CTCAG 1 cut(s) 542
BseRI GAGGAG 2 cut(s) 265, 393
BseXI GCAGC 2 cut(s) 62, 134
Bsh1285I CGRYCG 1 cut(s) 225
BshFI GGCC 1 cut(s) 263
BsiEI CGRYCG 1 cut(s) 225
BsiHKAI GWGCWC 1 cut(s) 98
BsiHKCI CYCGRG 1 cut(s) 392
BslI CCNNNNNNNGG 3 cut(s) 11, 220, 533
BsmAI GTCTC 1 cut(s) 245
BsnI GGCC 1 cut(s) 263
BsoBI CYCGRG 1 cut(s) 392
Bsp1286I GDGCHC 1 cut(s) 98
Bsp1407I TGTACA 1 cut(s) 442
Bsp143I GATC 2 cut(s) 142, 187
BspACI CCGC 3 cut(s) 268, 351, 369
BspANI GGCC 1 cut(s) 263
BspCNI CTCAG 1 cut(s) 541
BspHI TCATGA 1 cut(s) 136
BspLI GGNNCC 1 cut(s) 399
BspPI GGATC 1 cut(s) 137
BsrGI TGTACA 1 cut(s) 442
BssECI CCNNGG 1 cut(s) 279
BssMI GATC 2 cut(s) 142, 187
BssT1I CCWWGG 1 cut(s) 279
Bst2UI CCWGG 1 cut(s) 127
Bst4CI ACNGT 2 cut(s) 181, 363
BstAPI GCANNNNNTGC 1 cut(s) 40
BstAUI TGTACA 1 cut(s) 442
BstDEI CTNAG 2 cut(s) 236, 528
BstKTI GATC 2 cut(s) 145, 190
BstMAI GTCTC 1 cut(s) 245
BstMBI GATC 2 cut(s) 142, 187
BstMCI CGRYCG 1 cut(s) 225
BstMWI GCNNNNNNNGC 2 cut(s) 40, 377
BstNI CCWGG 1 cut(s) 127
BstSCI CCNGG 1 cut(s) 125
BstV1I GCAGC 2 cut(s) 62, 134
Bsu36I CCTNAGG 1 cut(s) 528
BsuRI GGCC 1 cut(s) 263
CciI TCATGA 1 cut(s) 136
Csp6I GTAC 2 cut(s) 443, 524
CviAII CATG 2 cut(s) 23, 137
CviQI GTAC 2 cut(s) 443, 524
DdeI CTNAG 2 cut(s) 236, 528
DpnI GATC 2 cut(s) 144, 189
DpnII GATC 2 cut(s) 142, 187
EaeI YGGCCR 1 cut(s) 261
Eco130I CCWWGG 1 cut(s) 279
Eco81I CCTNAGG 1 cut(s) 528
Eco88I CYCGRG 1 cut(s) 392
EcoRII CCWGG 1 cut(s) 125
EcoT14I CCWWGG 1 cut(s) 279
ErhI CCWWGG 1 cut(s) 279
FaeI CATG 2 cut(s) 26, 140
FaiI YATR 4 cut(s) 24, 132, 138, 333
FalI AAGNNNNNCTT 2 cut(s) 308, 340
FatI CATG 2 cut(s) 22, 136
FblI GTMKAC 1 cut(s) 107
Fnu4HI GCNGC 3 cut(s) 51, 123, 351
Fsp4HI GCNGC 3 cut(s) 51, 123, 351
FspBI CTAG 1 cut(s) 387
GluI GCNGC 3 cut(s) 51, 123, 351
HaeIII GGCC 1 cut(s) 263
Hin1II CATG 2 cut(s) 26, 140
HincII GTYRAC 1 cut(s) 108
HindII GTYRAC 1 cut(s) 108
HindIII AAGCTT 1 cut(s) 506
HinfI GANTC 5 cut(s) 45, 104, 218, 423, 565
HphI GGTGA 3 cut(s) 184, 235, 304
Hpy166II GTNNAC 1 cut(s) 108
Hpy188I TCNGA 1 cut(s) 147
Hpy188III TCNNGA 2 cut(s) 137, 502
Hpy8I GTNNAC 1 cut(s) 108
Hpy99I CGWCG 3 cut(s) 103, 164, 524
HpyAV CCTTC 3 cut(s) 71, 180, 334
HpyCH4III ACNGT 2 cut(s) 181, 363
HpyCH4IV ACGT 1 cut(s) 522
HpyCH4V TGCA 1 cut(s) 34
HpyF10VI GCNNNNNNNGC 2 cut(s) 40, 377
HpyF3I CTNAG 2 cut(s) 236, 528
HpySE526I ACGT 1 cut(s) 522
Hsp92II CATG 2 cut(s) 26, 140
Kzo9I GATC 2 cut(s) 142, 187
LpnPI CCDG 7 cut(s) 69, 112, 139, 208, 431, 497, 515
Lsp1109I GCAGC 2 cut(s) 62, 134
LweI GCATC 1 cut(s) 504
MaeI CTAG 1 cut(s) 387
MaeII ACGT 1 cut(s) 522
MalI GATC 2 cut(s) 144, 189
MboI GATC 2 cut(s) 142, 187
MboII GAAGA 1 cut(s) 490
MhlI GDGCHC 1 cut(s) 98
MluCI AATT 5 cut(s) 428, 433, 480, 545, 552
MlyI GAGTC 3 cut(s) 113, 212, 574
MmeI TCCRAC 4 cut(s) 170, 226, 330, 382
MroXI GAANNNNTTC 1 cut(s) 169
MspR9I CCNGG 1 cut(s) 127
MvaI CCWGG 1 cut(s) 127
MwoI GCNNNNNNNGC 2 cut(s) 40, 377
NdeII GATC 2 cut(s) 142, 187
NlaIII CATG 2 cut(s) 26, 140
NlaIV GGNNCC 1 cut(s) 399
NmeAIII GCCGAG 1 cut(s) 178
PaeR7I CTCGAG 1 cut(s) 392
PagI TCATGA 1 cut(s) 136
PcsI WCGNNNNNNNCGW 2 cut(s) 104, 222
PdmI GAANNNNTTC 1 cut(s) 169
PfeI GAWTC 2 cut(s) 45, 423
PflFI GACNNNGTC 2 cut(s) 103, 221
PkrI GCNGC 3 cut(s) 52, 124, 352
PleI GAGTC 3 cut(s) 112, 212, 573
PpsI GAGTC 3 cut(s) 112, 212, 573
Psp6I CCWGG 1 cut(s) 125
PspGI CCWGG 1 cut(s) 125
PspN4I GGNNCC 1 cut(s) 399
PspXI VCTCGAGB 1 cut(s) 392
PsyI GACNNNGTC 2 cut(s) 103, 221
RsaI GTAC 2 cut(s) 444, 525
RsaNI GTAC 2 cut(s) 443, 524
SalI GTCGAC 1 cut(s) 106
SatI GCNGC 3 cut(s) 51, 123, 351
Sau3AI GATC 2 cut(s) 142, 187
SchI GAGTC 3 cut(s) 113, 212, 574
ScrFI CCNGG 1 cut(s) 127
SduI GDGCHC 1 cut(s) 98
SfaNI GCATC 1 cut(s) 504
Sfr274I CTCGAG 1 cut(s) 392
SlaI CTCGAG 1 cut(s) 392
SmlI CTYRAG 1 cut(s) 392
SmoI CTYRAG 1 cut(s) 392
Sse9I AATT 5 cut(s) 428, 433, 480, 545, 552
SsiI CCGC 3 cut(s) 268, 351, 369
SspMI CTAG 1 cut(s) 387
StyD4I CCNGG 1 cut(s) 125
StyI CCWWGG 1 cut(s) 279
TaaI ACNGT 2 cut(s) 181, 363
TaiI ACGT 1 cut(s) 525
TaqI TCGA 7 cut(s) 107, 186, 216, 225, 342, 393, 519
TaqII GACCGA 1 cut(s) 211
TasI AATT 5 cut(s) 428, 433, 480, 545, 552
TatI WGTACW 1 cut(s) 442
TauI GCSGC 1 cut(s) 353
TfiI GAWTC 2 cut(s) 45, 423
TseI GCWGC 2 cut(s) 50, 122
TspGWI ACGGA 2 cut(s) 116, 177
Tth111I GACNNNGTC 2 cut(s) 103, 221
XapI RAATTY 2 cut(s) 433, 480
XhoI CTCGAG 1 cut(s) 392
XmiI GTMKAC 1 cut(s) 107
XmnI GAANNNNTTC 1 cut(s) 169
XspI CTAG 1 cut(s) 387
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.