Rmu_sc0000258.1_g000037

UPF0496 protein At4g34320-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000258.1
OG0020647
Physical Location & Seq
Reverse (-)
160442 .. 161554
1113 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 1113 bp
atggcatctgtccaaggaaatctagattgggaagacttgatggtatcctatgagaccgattaccaaagtgatgacgacttgaaaaagttacacgccaacttcaccgccggtgccaatgaagtcatgaggatgagtagcggtcttgatcgtttcaagcaaagtatattgtatctgaggaattccgaccgggacactgtggggacaatcatgtcctgcaaaaaaaaaatacttgctgcaaggggcgatgaggcgactgagattgagaatattttagataaacacctcatcaagcagtacttagaaaatagtcagcagacgcttgcactctgcgaggtggaattgccagaattcatcgaaaaagctaataaggtcgcttcatgcattgaagatgtggtgagtaaaaggaggatgttgaagaagcttaatacagctaagattaagtatgacgattccgccaaagtgattgttgaaaagcttgtatctctgcaggaccaacatctaaccttgcttgacaaactgaacgcagaattcagggagcttagcgagaggctggagaatattcgtacagttagcaaggtcgtaaatgtgatattcataggatttctttctgctgtgtttgcttgcagcgtcatggcagcaactatgactattcccggtgttgcagcggccatgagctctcatcctggtgttgcagcatttattgctgctagtgctgttgctcaatctacttcctcggcaataaaagtgggagaacattggcttctcaatatgattagagaatcaaaatcaactttggaggcacgtcagaatttgattgcgtccatgaaatccggaacaaacgatgccattaaagtgttggacgacattatgcatcatgttgataaggttattgaaagcggcaatgatccatgtttgtccattgcaaatgagcgaccagtggatttggacgcaaagctgaagaagtttcagaaagaaattaaggaattggacaagacaagggaggcatgcatccctgttataaaaaatgcaaggatacaggttaacgatgaatataagaagttgaaggagatgttattggaccgtcgcaaaagcaagctcctgtcaaaaaaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF677

Protein Analysis

370

Amino Acids

41.45

Weight (kDa)

8.07

Isoelectric Point (pI)

38.33

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF677 PF05055 42 - 347 5.2e-16 Protein of unknown function (DUF677)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020647)

Species Orthologous Gene IDs
rosa_laevigata RLG00000013221
rosa_multiflora Rmu_sc0000258.1_g000037
rosa_roxburghii Rroxscaffold_7G00190000 Rroxscaffold_7G00190030
rosa_samantha Rh6BG231100
rosa_wichuraiana Rw6G019840

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 1019
AasI GACNNNNNNGTC 1 cut(s) 208
AccB1I GGYRCC 1 cut(s) 110
AccIII TCCGGA 1 cut(s) 830
AciI CCGC 5 cut(s) 105, 138, 453, 665, 897
AclWI GGATC 1 cut(s) 899
AcoI YGGCCR 1 cut(s) 666
AcsI RAATTY 4 cut(s) 178, 347, 527, 808
AcuI CTGAAG 1 cut(s) 977
AfaI GTAC 2 cut(s) 296, 565
AgsI TTSAA 7 cut(s) 82, 154, 386, 415, 470, 893, 1063
AjiI CACGTC 1 cut(s) 803
AjnI CCWGG 1 cut(s) 682
AjuI GAANNNNNNNTTGG 2 cut(s) 10, 42
AluBI AGCT 8 cut(s) 362, 421, 431, 475, 538, 675, 955, 1096
AluI AGCT 8 cut(s) 362, 421, 431, 475, 538, 675, 955, 1096
Alw21I GWGCWC 1 cut(s) 677
Alw26I GTCTC 1 cut(s) 47
AlwI GGATC 1 cut(s) 899
Aor13HI TCCGGA 1 cut(s) 830
AoxI GGCC 1 cut(s) 666
ApeKI GCWGC 6 cut(s) 233, 624, 635, 662, 692, 704
ApoI RAATTY 4 cut(s) 178, 347, 527, 808
AspS9I GGNCC 2 cut(s) 490, 1078
AsuC2I CCSGG 2 cut(s) 188, 654
AsuHPI GGTGA 2 cut(s) 94, 406
AvaII GGWCC 2 cut(s) 490, 1078
BanI GGYRCC 1 cut(s) 110
BanII GRGCYC 1 cut(s) 677
BbsI GAAGAC 1 cut(s) 39
Bbv12I GWGCWC 1 cut(s) 677
BbvI GCAGC 6 cut(s) 220, 636, 647, 674, 691, 704
BccI CCATC 1 cut(s) 34
BciT130I CCWGG 1 cut(s) 684
BciVI GTATCC 2 cut(s) 55, 1026
BcnI CCSGG 2 cut(s) 188, 654
BcoDI GTCTC 1 cut(s) 47
BfaI CTAG 2 cut(s) 23, 708
BfmI CTRYAG 1 cut(s) 485
BfuI GTATCC 2 cut(s) 55, 1026
BisI GCNGC 8 cut(s) 234, 625, 636, 663, 666, 693, 705, 898
BlpI GCTNAGC 1 cut(s) 539
BlsI GCNGC 8 cut(s) 235, 626, 637, 664, 667, 694, 706, 899
BmcAI AGTACT 1 cut(s) 296
Bme1390I CCNGG 3 cut(s) 188, 654, 684
Bme18I GGWCC 2 cut(s) 490, 1078
BmgBI CACGTC 1 cut(s) 803
BmgT120I GGNCC 2 cut(s) 490, 1078
BmiI GGNNCC 1 cut(s) 112
BmrFI CCNGG 3 cut(s) 188, 654, 684
BmsI GCATC 4 cut(s) 14, 832, 880, 1017
BpiI GAAGAC 1 cut(s) 39
BpmI CTGGAG 1 cut(s) 572
Bpu1102I GCTNAGC 1 cut(s) 539
BpuMI CCSGG 2 cut(s) 188, 654
BsaI GGTCTC 1 cut(s) 47
BsaJI CCNNGG 2 cut(s) 13, 732
BsaWI WCCGGW 1 cut(s) 830
Bse118I RCCGGY 1 cut(s) 107
Bse1I ACTGG 1 cut(s) 935
Bse3DI GCAATG 2 cut(s) 907, 918
BseAI TCCGGA 1 cut(s) 830
BseBI CCWGG 1 cut(s) 684
BseDI CCNNGG 2 cut(s) 13, 732
BseGI GGATG 4 cut(s) 135, 414, 679, 1008
BseMI GCAATG 2 cut(s) 907, 918
BseMII CTCAG 2 cut(s) 164, 246
BseNI ACTGG 1 cut(s) 935
BseXI GCAGC 6 cut(s) 220, 636, 647, 674, 691, 704
Bsh1285I CGRYCG 1 cut(s) 187
BshFI GGCC 1 cut(s) 668
BshNI GGYRCC 1 cut(s) 110
BsiEI CGRYCG 1 cut(s) 187
BsiHKAI GWGCWC 1 cut(s) 677
BsiSI CCGG 4 cut(s) 108, 187, 654, 831
BslFI GGGAC 2 cut(s) 203, 214
BsmAI GTCTC 1 cut(s) 47
BsmFI GGGAC 2 cut(s) 203, 214
BsnI GGCC 1 cut(s) 668
Bso31I GGTCTC 1 cut(s) 47
Bsp1286I GDGCHC 1 cut(s) 677
Bsp13I TCCGGA 1 cut(s) 830
Bsp143I GATC 2 cut(s) 145, 904
Bsp1720I GCTNAGC 1 cut(s) 539
BspACI CCGC 5 cut(s) 105, 138, 453, 665, 897
BspANI GGCC 1 cut(s) 668
BspCNI CTCAG 2 cut(s) 165, 247
BspEI TCCGGA 1 cut(s) 830
BspHI TCATGA 1 cut(s) 123
BspLI GGNNCC 1 cut(s) 112
BspMAI CTGCAG 1 cut(s) 489
BspPI GGATC 1 cut(s) 899
BspT107I GGYRCC 1 cut(s) 110
BspTNI GGTCTC 1 cut(s) 47
BsrDI GCAATG 2 cut(s) 907, 918
BsrFI RCCGGY 1 cut(s) 107
BsrI ACTGG 1 cut(s) 935
BssAI RCCGGY 1 cut(s) 107
BssECI CCNNGG 2 cut(s) 13, 732
BssMI GATC 2 cut(s) 145, 904
BssT1I CCWWGG 1 cut(s) 13
Bst2UI CCWGG 1 cut(s) 684
Bst4CI ACNGT 3 cut(s) 196, 568, 1082
BstAPI GCANNNNNTGC 1 cut(s) 701
BstC8I GCNNGC 4 cut(s) 321, 622, 1006, 1094
BstDEI CTNAG 5 cut(s) 173, 255, 298, 432, 539
BstF5I GGATG 4 cut(s) 135, 414, 679, 1008
BstKTI GATC 2 cut(s) 148, 907
BstMAI GTCTC 1 cut(s) 47
BstMBI GATC 2 cut(s) 145, 904
BstMCI CGRYCG 1 cut(s) 187
BstMWI GCNNNNNNNGC 3 cut(s) 617, 701, 710
BstNI CCWGG 1 cut(s) 684
BstNSI RCATGY 1 cut(s) 1008
BstSCI CCNGG 3 cut(s) 186, 652, 682
BstSFI CTRYAG 1 cut(s) 485
BstV1I GCAGC 6 cut(s) 220, 636, 647, 674, 691, 704
BstV2I GAAGAC 1 cut(s) 39
BsuI GTATCC 2 cut(s) 55, 1026
BsuRI GGCC 1 cut(s) 668
BtgZI GCGATG 1 cut(s) 258
BtrI CACGTC 1 cut(s) 803
BtsCI GGATG 4 cut(s) 135, 414, 679, 1008
BtsIMutI CAGTG 2 cut(s) 192, 942
Cac8I GCNNGC 4 cut(s) 321, 622, 1006, 1094
CciI TCATGA 1 cut(s) 123
Cfr10I RCCGGY 1 cut(s) 107
Cfr13I GGNCC 2 cut(s) 490, 1078
CseI GACGC 4 cut(s) 325, 616, 807, 956
Csp6I GTAC 2 cut(s) 295, 564
CspCI CAANNNNNGTGG 2 cut(s) 726, 761
CviAII CATG 9 cut(s) 124, 208, 378, 631, 670, 823, 875, 909, 1005
CviQI GTAC 2 cut(s) 295, 564
DdeI CTNAG 5 cut(s) 173, 255, 298, 432, 539
DpnI GATC 2 cut(s) 147, 906
DpnII GATC 2 cut(s) 145, 904
DrdI GACNNNNNNGTC 1 cut(s) 208
DseDI GACNNNNNNGTC 1 cut(s) 208
EaeI YGGCCR 1 cut(s) 666
EciI GGCGGA 1 cut(s) 442
Ecl136II GAGCTC 1 cut(s) 675
Eco130I CCWWGG 1 cut(s) 13
Eco24I GRGCYC 1 cut(s) 677
Eco31I GGTCTC 1 cut(s) 47
Eco47I GGWCC 2 cut(s) 490, 1078
Eco53kI GAGCTC 1 cut(s) 675
Eco57I CTGAAG 1 cut(s) 977
EcoICRI GAGCTC 1 cut(s) 675
EcoRI GAATTC 3 cut(s) 178, 347, 527
EcoRII CCWGG 1 cut(s) 682
EcoT14I CCWWGG 1 cut(s) 13
EcoT22I ATGCAT 3 cut(s) 383, 873, 1010
EcoT38I GRGCYC 1 cut(s) 677
ErhI CCWWGG 1 cut(s) 13
FaeI CATG 9 cut(s) 127, 211, 381, 634, 673, 826, 878, 912, 1008
FalI AAGNNNNNCTT 2 cut(s) 281, 313
FaqI GGGAC 2 cut(s) 203, 214
FatI CATG 9 cut(s) 123, 207, 377, 630, 669, 822, 874, 908, 1004
Fnu4HI GCNGC 8 cut(s) 234, 625, 636, 663, 666, 693, 705, 898
FokI GGATG 4 cut(s) 142, 421, 666, 995
FriOI GRGCYC 1 cut(s) 677
Fsp4HI GCNGC 8 cut(s) 234, 625, 636, 663, 666, 693, 705, 898
FspBI CTAG 2 cut(s) 23, 708
GluI GCNGC 8 cut(s) 234, 625, 636, 663, 666, 693, 705, 898
GsuI CTGGAG 1 cut(s) 572
HaeIII GGCC 1 cut(s) 668
HapII CCGG 4 cut(s) 108, 187, 654, 831
HgaI GACGC 4 cut(s) 325, 616, 807, 956
Hin1II CATG 9 cut(s) 127, 211, 381, 634, 673, 826, 878, 912, 1008
HincII GTYRAC 1 cut(s) 1042
HindII GTYRAC 1 cut(s) 1042
HindIII AAGCTT 2 cut(s) 419, 473
HinfI GANTC 2 cut(s) 449, 779
HpaI GTTAAC 1 cut(s) 1042
HpaII CCGG 4 cut(s) 108, 187, 654, 831
HphI GGTGA 2 cut(s) 94, 406
Hpy166II GTNNAC 1 cut(s) 1042
Hpy188I TCNGA 4 cut(s) 174, 184, 807, 969
Hpy188III TCNNGA 4 cut(s) 23, 124, 143, 831
Hpy8I GTNNAC 1 cut(s) 1042
Hpy99I CGWCG 1 cut(s) 1086
HpyAV CCTTC 1 cut(s) 1057
HpyCH4III ACNGT 3 cut(s) 196, 568, 1082
HpyCH4IV ACGT 1 cut(s) 802
HpyF10VI GCNNNNNNNGC 3 cut(s) 617, 701, 710
HpyF3I CTNAG 5 cut(s) 173, 255, 298, 432, 539
HpySE526I ACGT 1 cut(s) 802
Hsp92II CATG 9 cut(s) 127, 211, 381, 634, 673, 826, 878, 912, 1008
Kpn2I TCCGGA 1 cut(s) 830
KspAI GTTAAC 1 cut(s) 1042
Kzo9I GATC 2 cut(s) 145, 904
LmnI GCTCC 2 cut(s) 535, 1101
Lsp1109I GCAGC 6 cut(s) 220, 636, 647, 674, 691, 704
LweI GCATC 4 cut(s) 14, 832, 880, 1017
MaeI CTAG 2 cut(s) 23, 708
MaeII ACGT 1 cut(s) 802
MaeIII GTNAC 1 cut(s) 87
MalI GATC 2 cut(s) 147, 906
MboI GATC 2 cut(s) 145, 904
MboII GAAGA 4 cut(s) 44, 398, 427, 970
MhlI GDGCHC 1 cut(s) 677
MluCI AATT 7 cut(s) 178, 338, 347, 527, 808, 975, 983
MmeI TCCRAC 2 cut(s) 207, 837
Mph1103I ATGCAT 3 cut(s) 383, 873, 1010
MroI TCCGGA 1 cut(s) 830
MseI TTAA 5 cut(s) 423, 438, 849, 978, 1041
MslI CAYNNNNRTG 3 cut(s) 128, 684, 851
MspA1I CMGCKG 1 cut(s) 665
MspI CCGG 4 cut(s) 108, 187, 654, 831
MspR9I CCNGG 3 cut(s) 188, 654, 684
MvaI CCWGG 1 cut(s) 684
MwoI GCNNNNNNNGC 3 cut(s) 617, 701, 710
NciI CCSGG 2 cut(s) 188, 654
NdeII GATC 2 cut(s) 145, 904
NlaIII CATG 9 cut(s) 127, 211, 381, 634, 673, 826, 878, 912, 1008
NlaIV GGNNCC 1 cut(s) 112
NmeAIII GCCGAG 1 cut(s) 713
NsiI ATGCAT 3 cut(s) 383, 873, 1010
NspI RCATGY 1 cut(s) 1008
PaeI GCATGC 1 cut(s) 1008
PagI TCATGA 1 cut(s) 123
PfeI GAWTC 2 cut(s) 449, 779
PkrI GCNGC 8 cut(s) 235, 626, 637, 664, 667, 694, 706, 899
PsiI TTATAA 1 cut(s) 1019
Psp124BI GAGCTC 1 cut(s) 677
Psp6I CCWGG 1 cut(s) 682
PspGI CCWGG 1 cut(s) 682
PspN4I GGNNCC 1 cut(s) 112
PspPI GGNCC 2 cut(s) 490, 1078
PstI CTGCAG 1 cut(s) 489
RsaI GTAC 2 cut(s) 296, 565
RsaNI GTAC 2 cut(s) 295, 564
RseI CAYNNNNRTG 3 cut(s) 128, 684, 851
SacI GAGCTC 1 cut(s) 677
SaqAI TTAA 5 cut(s) 423, 438, 849, 978, 1041
SatI GCNGC 8 cut(s) 234, 625, 636, 663, 666, 693, 705, 898
Sau3AI GATC 2 cut(s) 145, 904
Sau96I GGNCC 2 cut(s) 490, 1078
ScaI AGTACT 1 cut(s) 296
ScrFI CCNGG 3 cut(s) 188, 654, 684
SduI GDGCHC 1 cut(s) 677
SfaNI GCATC 4 cut(s) 14, 832, 880, 1017
SfcI CTRYAG 1 cut(s) 485
SgrAI CRCCGGYG 1 cut(s) 107
SinI GGWCC 2 cut(s) 490, 1078
SmiMI CAYNNNNRTG 3 cut(s) 128, 684, 851
SphI GCATGC 1 cut(s) 1008
Sse9I AATT 7 cut(s) 178, 338, 347, 527, 808, 975, 983
SsiI CCGC 5 cut(s) 105, 138, 453, 665, 897
SspI AATATT 2 cut(s) 268, 559
SspMI CTAG 2 cut(s) 23, 708
SstI GAGCTC 1 cut(s) 677
StyD4I CCNGG 3 cut(s) 186, 652, 682
StyI CCWWGG 1 cut(s) 13
TaaI ACNGT 3 cut(s) 196, 568, 1082
TaiI ACGT 1 cut(s) 805
TaqI TCGA 1 cut(s) 354
TaqII GACCGA 1 cut(s) 71
TasI AATT 7 cut(s) 178, 338, 347, 527, 808, 975, 983
TatI WGTACW 1 cut(s) 294
TauI GCSGC 2 cut(s) 668, 900
TfiI GAWTC 2 cut(s) 449, 779
Tru1I TTAA 5 cut(s) 423, 438, 849, 978, 1041
Tru9I TTAA 5 cut(s) 423, 438, 849, 978, 1041
TscAI CASTG 2 cut(s) 199, 942
TseI GCWGC 6 cut(s) 233, 624, 635, 662, 692, 704
TspDTI ATGAA 6 cut(s) 132, 340, 366, 583, 839, 1062
TspRI CASTG 2 cut(s) 199, 942
VpaK11BI GGWCC 2 cut(s) 490, 1078
XapI RAATTY 4 cut(s) 178, 347, 527, 808
XbaI TCTAGA 1 cut(s) 22
XceI RCATGY 1 cut(s) 1008
XcmI CCANNNNNNNNNTGG 1 cut(s) 853
XspI CTAG 2 cut(s) 23, 708
ZrmI AGTACT 1 cut(s) 296
Zsp2I ATGCAT 3 cut(s) 383, 873, 1010
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.