Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000273.1

Orthogroup ID

OG0019865

Physical Location & Seq

Genomic Coordinates Forward (+)

10327 .. 10641

Gene Structure 315 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000273.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 315 bp

atgtttacggggaagaaaccaactgatcacatgttcagtggtggctcgaatcttcataaatttgtgaagaccactctagcacaacgtgttacagagataacagattcaagattacttcaaggagataccgactatactaaagaaaatgtaaagctattgagtttgatatttgaaattggaattgcatattccgctgaggccccaagagaccagacagatgtcagtgacgttgcatctgaattgctttctattagagaccgtcttcttgcatcagaaacatcggaaagttttctgctgtgttatgggttgcagtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04010 ko04064 ko04620 ko04624 ko04722 ko05133 ko05140 ko05142 ko05145 ko05152 ko05162 ko05169 map04010 map04064 map04620 map04624 map04722 map05133 map05140 map05142 map05145 map05152 map05162 map05169

Pfam Domains

Protein Families

LRRNT_2 LRR_1 LRR_8 Pkinase Pkinase_Tyr

Protein Analysis

104

Amino Acids

11.58

Weight (kDa)

5.04

Isoelectric Point (pI)

28.27

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019865)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0355671
rosa_laevigata	RLG00000028133
rosa_multiflora	Rmu_sc0000273.1_g000001 Rmu_sc0002037.1_g000003 Rmu_sc0002037.1_g000026
rosa_roxburghii	Rroxscaffold_4G00300450
rosa_rugosa	Rorug01G0247400

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	192
AcsI	RAATTY	1 cut(s)	59
AdeI	CACNNNGTG	1 cut(s)	86
AflIII	ACRYGT	2 cut(s)	30, 85
AgsI	TTSAA	3 cut(s)	108, 119, 173
AluBI	AGCT	1 cut(s)	154
AluI	AGCT	1 cut(s)	154
Alw26I	GTCTC	2 cut(s)	201, 249
AoxI	GGCC	1 cut(s)	198
ApoI	RAATTY	1 cut(s)	59
Asp700I	GAANNNNTTC	1 cut(s)	288
AspS9I	GGNCC	1 cut(s)	199
BbsI	GAAGAC	2 cut(s)	74, 254
BbvCI	CCTCAGC	1 cut(s)	195
BclI	TGATCA	1 cut(s)	25
BcoDI	GTCTC	2 cut(s)	201, 249
BfaI	CTAG	1 cut(s)	77
BmgT120I	GGNCC	1 cut(s)	199
BmiI	GGNNCC	1 cut(s)	201
BmsI	GCATC	2 cut(s)	242, 278
BoxI	GACNNNNGTC	1 cut(s)	218
BpiI	GAAGAC	2 cut(s)	74, 254
Bpu10I	CCTNAGC	1 cut(s)	195
BsaI	GGTCTC	2 cut(s)	201, 249
BseMII	CTCAG	1 cut(s)	186
BshFI	GGCC	1 cut(s)	200
BsmAI	GTCTC	2 cut(s)	201, 249
BsnI	GGCC	1 cut(s)	200
Bso31I	GGTCTC	2 cut(s)	201, 249
Bsp143I	GATC	1 cut(s)	25
BspACI	CCGC	1 cut(s)	192
BspANI	GGCC	1 cut(s)	200
BspCNI	CTCAG	1 cut(s)	187
BspLI	GGNNCC	1 cut(s)	201
BspTNI	GGTCTC	2 cut(s)	201, 249
BssMI	GATC	1 cut(s)	25
Bst4CI	ACNGT	1 cut(s)	260
BstDEI	CTNAG	1 cut(s)	195
BstKTI	GATC	1 cut(s)	28
BstMAI	GTCTC	2 cut(s)	201, 249
BstMBI	GATC	1 cut(s)	25
BstMWI	GCNNNNNNNGC	1 cut(s)	191
BstNSI	RCATGY	1 cut(s)	34
BstPAI	GACNNNNGTC	1 cut(s)	218
BstV2I	GAAGAC	2 cut(s)	74, 254
BsuRI	GGCC	1 cut(s)	200
BtsIMutI	CAGTG	2 cut(s)	43, 229
Cfr13I	GGNCC	1 cut(s)	199
CviAII	CATG	1 cut(s)	31
CviJI	RGCY	3 cut(s)	45, 154, 200
CviKI_1	RGCY	3 cut(s)	45, 154, 200
DdeI	CTNAG	1 cut(s)	195
DpnI	GATC	1 cut(s)	27
DpnII	GATC	1 cut(s)	25
DraIII	CACNNNGTG	1 cut(s)	86
Eco31I	GGTCTC	2 cut(s)	201, 249
EcoO109I	RGGNCCY	1 cut(s)	199
FaeI	CATG	1 cut(s)	34
FaiI	YATR	5 cut(s)	32, 57, 135, 187, 303
FatI	CATG	1 cut(s)	30
FbaI	TGATCA	1 cut(s)	25
FspBI	CTAG	1 cut(s)	77
HaeIII	GGCC	1 cut(s)	200
Hin1II	CATG	1 cut(s)	34
HinfI	GANTC	2 cut(s)	49, 104
Hpy166II	GTNNAC	1 cut(s)	6
Hpy188I	TCNGA	3 cut(s)	238, 274, 283
Hpy188III	TCNNGA	1 cut(s)	108
Hpy8I	GTNNAC	1 cut(s)	6
HpyCH4III	ACNGT	1 cut(s)	260
HpyCH4IV	ACGT	2 cut(s)	85, 228
HpyCH4V	TGCA	4 cut(s)	185, 233, 269, 310
HpyF10VI	GCNNNNNNNGC	1 cut(s)	191
HpyF3I	CTNAG	1 cut(s)	195
HpySE526I	ACGT	2 cut(s)	85, 228
Hsp92II	CATG	1 cut(s)	34
Ksp22I	TGATCA	1 cut(s)	25
Kzo9I	GATC	1 cut(s)	25
LpnPI	CCDG	1 cut(s)	224
LweI	GCATC	2 cut(s)	242, 278
MaeI	CTAG	1 cut(s)	77
MaeII	ACGT	2 cut(s)	85, 228
MaeIII	GTNAC	2 cut(s)	88, 224
MalI	GATC	1 cut(s)	27
MboI	GATC	1 cut(s)	25
MboII	GAAGA	4 cut(s)	25, 44, 79, 254
MluCI	AATT	4 cut(s)	59, 174, 180, 239
MnlI	CCTC	1 cut(s)	190
MroXI	GAANNNNTTC	1 cut(s)	288
MspA1I	CMGCKG	1 cut(s)	194
MwoI	GCNNNNNNNGC	1 cut(s)	191
NdeII	GATC	1 cut(s)	25
NlaIII	CATG	1 cut(s)	34
NlaIV	GGNNCC	1 cut(s)	201
NmuCI	GTSAC	1 cut(s)	224
NspI	RCATGY	1 cut(s)	34
PciI	ACATGT	1 cut(s)	30
PdmI	GAANNNNTTC	1 cut(s)	288
PfeI	GAWTC	2 cut(s)	49, 104
PscI	ACATGT	1 cut(s)	30
PshAI	GACNNNNGTC	1 cut(s)	218
PspN4I	GGNNCC	1 cut(s)	201
PspPI	GGNCC	1 cut(s)	199
Sau3AI	GATC	1 cut(s)	25
Sau96I	GGNCC	1 cut(s)	199
SetI	ASST	3 cut(s)	88, 156, 231
SfaNI	GCATC	2 cut(s)	242, 278
Sse9I	AATT	4 cut(s)	59, 174, 180, 239
SsiI	CCGC	1 cut(s)	192
SspMI	CTAG	1 cut(s)	77
TaaI	ACNGT	1 cut(s)	260
TaiI	ACGT	2 cut(s)	88, 231
TaqI	TCGA	1 cut(s)	47
TasI	AATT	4 cut(s)	59, 174, 180, 239
TfiI	GAWTC	2 cut(s)	49, 104
TscAI	CASTG	2 cut(s)	43, 229
TseFI	GTSAC	1 cut(s)	224
Tsp45I	GTSAC	1 cut(s)	224
TspDTI	ATGAA	1 cut(s)	44
TspRI	CASTG	2 cut(s)	43, 229
XapI	RAATTY	1 cut(s)	59
XceI	RCATGY	1 cut(s)	34
XmnI	GAANNNNTTC	1 cut(s)	288
XspI	CTAG	1 cut(s)	77

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.