Rmu_sc0002037.1_g000003

LRR receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002037.1
Physical Location & Seq
Forward (+)
12923 .. 13237
315 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002037.1_g000003.1.cds

Sequence Viewer

Length: 315 bp
atgtttacggggaagaaaccaactgatcacatgttcagtgacggctcgaatcttcataaatttgtgaagaccgctctagcacaacgtgttacagagataacagattcaagattacttcaaggagataccgactatgctaaagaaaatgtaaagctattgagtttgatatttgaaattggaattgagtattctgctgaggtcccaagagaccagatagatgtcagtgacgttgcatctgaattgctttccattagagaccgtcttcttgcatcagaaacatcagaaagttttcaactttgttatggattgcagtag

Protein Analysis

104

Amino Acids

11.69

Weight (kDa)

4.77

Isoelectric Point (pI)

34.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019865)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 74
AciI CCGC 1 cut(s) 72
AcsI RAATTY 1 cut(s) 59
AdeI CACNNNGTG 1 cut(s) 86
AflIII ACRYGT 2 cut(s) 30, 85
AgsI TTSAA 4 cut(s) 108, 119, 173, 293
AluBI AGCT 1 cut(s) 154
AluI AGCT 1 cut(s) 154
Alw26I GTCTC 2 cut(s) 201, 249
ApoI RAATTY 1 cut(s) 59
Asp700I GAANNNNTTC 1 cut(s) 288
AspS9I GGNCC 1 cut(s) 199
AvaII GGWCC 1 cut(s) 199
BbsI GAAGAC 2 cut(s) 74, 254
BbvCI CCTCAGC 1 cut(s) 195
BceAI ACGGC 1 cut(s) 58
BclI TGATCA 1 cut(s) 25
BcoDI GTCTC 2 cut(s) 201, 249
BfaI CTAG 1 cut(s) 77
Bme18I GGWCC 1 cut(s) 199
BmgT120I GGNCC 1 cut(s) 199
BmiI GGNNCC 1 cut(s) 201
BmsI GCATC 2 cut(s) 242, 278
BpiI GAAGAC 2 cut(s) 74, 254
Bpu10I CCTNAGC 1 cut(s) 195
BsaI GGTCTC 2 cut(s) 201, 249
BseMII CTCAG 1 cut(s) 186
BslFI GGGAC 1 cut(s) 185
BsmAI GTCTC 2 cut(s) 201, 249
BsmFI GGGAC 1 cut(s) 185
Bso31I GGTCTC 2 cut(s) 201, 249
Bsp143I GATC 1 cut(s) 25
BspACI CCGC 1 cut(s) 72
BspCNI CTCAG 1 cut(s) 187
BspLI GGNNCC 1 cut(s) 201
BspTNI GGTCTC 2 cut(s) 201, 249
BsrBI CCGCTC 1 cut(s) 74
BssMI GATC 1 cut(s) 25
Bst4CI ACNGT 1 cut(s) 260
BstDEI CTNAG 1 cut(s) 195
BstKTI GATC 1 cut(s) 28
BstMAI GTCTC 2 cut(s) 201, 249
BstMBI GATC 1 cut(s) 25
BstNSI RCATGY 1 cut(s) 34
BstV2I GAAGAC 2 cut(s) 74, 254
BtsIMutI CAGTG 2 cut(s) 43, 229
Cfr13I GGNCC 1 cut(s) 199
CviAII CATG 1 cut(s) 31
CviJI RGCY 2 cut(s) 45, 154
CviKI_1 RGCY 2 cut(s) 45, 154
DdeI CTNAG 1 cut(s) 195
DpnI GATC 1 cut(s) 27
DpnII GATC 1 cut(s) 25
DraIII CACNNNGTG 1 cut(s) 86
Eco31I GGTCTC 2 cut(s) 201, 249
Eco47I GGWCC 1 cut(s) 199
EcoO109I RGGNCCY 1 cut(s) 199
FaeI CATG 1 cut(s) 34
FaiI YATR 4 cut(s) 32, 57, 135, 303
FaqI GGGAC 1 cut(s) 185
FatI CATG 1 cut(s) 30
FbaI TGATCA 1 cut(s) 25
FspBI CTAG 1 cut(s) 77
Hin1II CATG 1 cut(s) 34
HinfI GANTC 2 cut(s) 49, 104
Hpy166II GTNNAC 1 cut(s) 6
Hpy188I TCNGA 3 cut(s) 238, 274, 283
Hpy188III TCNNGA 1 cut(s) 108
Hpy8I GTNNAC 1 cut(s) 6
HpyCH4III ACNGT 1 cut(s) 260
HpyCH4IV ACGT 2 cut(s) 85, 228
HpyCH4V TGCA 3 cut(s) 233, 269, 310
HpyF3I CTNAG 1 cut(s) 195
HpySE526I ACGT 2 cut(s) 85, 228
Hsp92II CATG 1 cut(s) 34
Ksp22I TGATCA 1 cut(s) 25
Kzo9I GATC 1 cut(s) 25
LpnPI CCDG 1 cut(s) 224
LweI GCATC 2 cut(s) 242, 278
MaeI CTAG 1 cut(s) 77
MaeII ACGT 2 cut(s) 85, 228
MaeIII GTNAC 3 cut(s) 38, 88, 224
MalI GATC 1 cut(s) 27
MbiI CCGCTC 1 cut(s) 74
MboI GATC 1 cut(s) 25
MboII GAAGA 4 cut(s) 25, 44, 79, 254
MluCI AATT 4 cut(s) 59, 174, 180, 239
MnlI CCTC 1 cut(s) 190
MroXI GAANNNNTTC 1 cut(s) 288
NdeII GATC 1 cut(s) 25
NlaIII CATG 1 cut(s) 34
NlaIV GGNNCC 1 cut(s) 201
NmuCI GTSAC 2 cut(s) 38, 224
NspI RCATGY 1 cut(s) 34
PciI ACATGT 1 cut(s) 30
PdmI GAANNNNTTC 1 cut(s) 288
PfeI GAWTC 2 cut(s) 49, 104
PpuMI RGGWCCY 1 cut(s) 199
PscI ACATGT 1 cut(s) 30
Psp5II RGGWCCY 1 cut(s) 199
PspN4I GGNNCC 1 cut(s) 201
PspPI GGNCC 1 cut(s) 199
PspPPI RGGWCCY 1 cut(s) 199
Sau3AI GATC 1 cut(s) 25
Sau96I GGNCC 1 cut(s) 199
SetI ASST 4 cut(s) 88, 156, 201, 231
SfaNI GCATC 2 cut(s) 242, 278
SinI GGWCC 1 cut(s) 199
Sse9I AATT 4 cut(s) 59, 174, 180, 239
SsiI CCGC 1 cut(s) 72
SspMI CTAG 1 cut(s) 77
TaaI ACNGT 1 cut(s) 260
TaiI ACGT 2 cut(s) 88, 231
TaqI TCGA 1 cut(s) 47
TasI AATT 4 cut(s) 59, 174, 180, 239
TfiI GAWTC 2 cut(s) 49, 104
TscAI CASTG 2 cut(s) 43, 229
TseFI GTSAC 2 cut(s) 38, 224
Tsp45I GTSAC 2 cut(s) 38, 224
TspDTI ATGAA 1 cut(s) 44
TspRI CASTG 2 cut(s) 43, 229
VpaK11BI GGWCC 1 cut(s) 199
XapI RAATTY 1 cut(s) 59
XceI RCATGY 1 cut(s) 34
XmnI GAANNNNTTC 1 cut(s) 288
XspI CTAG 1 cut(s) 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.