Rmu_sc0000429.1_g000027

Catalytic subunit of the queuine tRNA-ribosyltransferase (TGT) that catalyzes the base-exchange of a guanine (G) residue with queuine (Q) at position 34 (anticodon wobble position) in tRNAs with GU(N) anticodons (tRNA-Asp, -Asn, -His and -Tyr), resulting in the hypermodified nucleoside queuosine (7-(((4,5-cis- dihydroxy-2-cyclopenten-1-yl)amino)methyl)-7-deazaguanosine). Catalysis occurs through a double-displacement mechanism. The nucleophile active site attacks the C1' of nucleotide 34 to detach the guanine base from the RNA, forming a covalent enzyme-RNA intermediate. The proton acceptor active site deprotonates the incoming queuine, allowing a nucleophilic attack on the C1' of the ribose to form the product

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000429.1
OG0021090
Physical Location & Seq
Forward (+)
108774 .. 111593
2820 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 552 bp
atggcgcttcgtttcgaggttttggggaggttcaatcgcgctcgtgcagctcaactgacactccctcactttgtgtgtcagactcctcttttcatgcctgttggagcacaaggaactataaaagggttggcaactgaccagcttgaggagattggttgccaaataattcttgggaatacatatcatttggcacttcgacctacctctgagcttattgacgagatgggaggtctccacaaatttatgaactggccaagagcgctgcttactgattctggtggctttcagatgtcaacagtcgatggaaagccaatgctcttgacacctgaggaattaattcaaatccaaaatagaattggagcagatattataatggcccttgatgatgtagtgaaaaccaccatcactggtccaagaatcgaggaggccatgtatcgtactctacgatggattgacaaatgtatagcagttacaaaagatgctatgggatctcagcttctgtcatatcacaatctgtattacatgctaaagctaagtagagatctacactaa

Protein Analysis

183

Amino Acids

20.59

Weight (kDa)

6.51

Isoelectric Point (pI)

37.74

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TGT PF01702 13 - 159 2.8e-55 Queuine tRNA-ribosyltransferase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021090)

Species Orthologous Gene IDs
fragaria_vesca FvH4_5g36560
rosa_chinensis RchiOBHm_Chr7g0242231
rosa_multiflora Rmu_sc0000429.1_g000027
rosa_samantha Rh1DG069500
rosa_wichuraiana Rw0G009470

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 371
AccII CGCG 1 cut(s) 39
AclWI GGATC 1 cut(s) 496
AcoI YGGCCR 1 cut(s) 251
AcsI RAATTY 1 cut(s) 239
AdeI CACNNNGTG 1 cut(s) 73
AfaI GTAC 1 cut(s) 439
AfeI AGCGCT 1 cut(s) 261
AfiI CCNNNNNNNGG 1 cut(s) 145
AgsI TTSAA 2 cut(s) 34, 341
AluBI AGCT 5 cut(s) 50, 142, 211, 496, 532
AluI AGCT 5 cut(s) 50, 142, 211, 496, 532
Alw21I GWGCWC 1 cut(s) 109
Alw26I GTCTC 1 cut(s) 236
AlwI GGATC 1 cut(s) 496
AlwNI CAGNNNCTG 1 cut(s) 499
Aor51HI AGCGCT 1 cut(s) 261
AoxI GGCC 3 cut(s) 251, 375, 426
ApeKI GCWGC 2 cut(s) 47, 262
ApoI RAATTY 1 cut(s) 239
AseI ATTAAT 1 cut(s) 335
Asp700I GAANNNNTTC 1 cut(s) 336
AspLEI GCGC 3 cut(s) 7, 41, 262
AspS9I GGNCC 2 cut(s) 376, 410
AvaII GGWCC 1 cut(s) 410
AxyI CCTNAGG 1 cut(s) 327
BalI TGGCCA 1 cut(s) 253
BauI CACGAG 1 cut(s) 42
Bbv12I GWGCWC 1 cut(s) 109
BbvI GCAGC 2 cut(s) 59, 249
BccI CCATC 4 cut(s) 217, 296, 410, 441
BcoDI GTCTC 1 cut(s) 236
BfoI RGCGCY 2 cut(s) 8, 263
BglII AGATCT 1 cut(s) 541
BisI GCNGC 2 cut(s) 48, 263
BlsI GCNGC 2 cut(s) 49, 264
Bme18I GGWCC 1 cut(s) 410
BmgT120I GGNCC 2 cut(s) 376, 410
BmsI GCATC 1 cut(s) 469
BpuEI CTTGAG 1 cut(s) 164
BsaI GGTCTC 1 cut(s) 236
BsaXI ACNNNNNCTCC 4 cut(s) 45, 75, 416, 446
Bsc4I CCNNNNNNNGG 1 cut(s) 145
Bse1I ACTGG 2 cut(s) 254, 412
Bse21I CCTNAGG 1 cut(s) 327
BseLI CCNNNNNNNGG 1 cut(s) 145
BseMII CTCAG 3 cut(s) 198, 318, 506
BseNI ACTGG 2 cut(s) 254, 412
BseRI GAGGAG 3 cut(s) 75, 161, 437
BseXI GCAGC 2 cut(s) 59, 249
BsgI GTGCAG 1 cut(s) 66
Bsh1236I CGCG 1 cut(s) 39
BshFI GGCC 3 cut(s) 253, 377, 428
BsiHKAI GWGCWC 1 cut(s) 109
BslI CCNNNNNNNGG 1 cut(s) 145
BsmAI GTCTC 1 cut(s) 236
BsnI GGCC 3 cut(s) 253, 377, 428
Bso31I GGTCTC 1 cut(s) 236
Bsp1286I GDGCHC 1 cut(s) 109
Bsp143I GATC 2 cut(s) 488, 541
BspANI GGCC 3 cut(s) 253, 377, 428
BspCNI CTCAG 3 cut(s) 199, 319, 505
BspFNI CGCG 1 cut(s) 39
BspPI GGATC 1 cut(s) 496
BspTNI GGTCTC 1 cut(s) 236
BsrI ACTGG 2 cut(s) 254, 412
BssMI GATC 2 cut(s) 488, 541
BssSI CACGAG 1 cut(s) 42
Bst2BI CACGAG 1 cut(s) 42
Bst4CI ACNGT 1 cut(s) 298
BstDEI CTNAG 4 cut(s) 207, 327, 492, 533
BstFNI CGCG 1 cut(s) 39
BstH2I RGCGCY 2 cut(s) 8, 263
BstHHI GCGC 3 cut(s) 7, 41, 262
BstKTI GATC 2 cut(s) 491, 544
BstMAI GTCTC 1 cut(s) 236
BstMBI GATC 2 cut(s) 488, 541
BstMWI GCNNNNNNNGC 2 cut(s) 47, 259
BstNSI RCATGY 1 cut(s) 526
BstUI CGCG 1 cut(s) 39
BstV1I GCAGC 2 cut(s) 59, 249
BstX2I RGATCY 2 cut(s) 488, 541
BstYI RGATCY 2 cut(s) 488, 541
Bsu36I CCTNAGG 1 cut(s) 327
BsuRI GGCC 3 cut(s) 253, 377, 428
BtsIMutI CAGTG 1 cut(s) 405
CaiI CAGNNNCTG 1 cut(s) 499
CfoI GCGC 3 cut(s) 7, 41, 262
Cfr13I GGNCC 2 cut(s) 376, 410
Csp6I GTAC 1 cut(s) 438
CviAII CATG 3 cut(s) 94, 430, 523
CviQI GTAC 1 cut(s) 438
DdeI CTNAG 4 cut(s) 207, 327, 492, 533
DpnI GATC 2 cut(s) 490, 543
DpnII GATC 2 cut(s) 488, 541
DraIII CACNNNGTG 1 cut(s) 73
EaeI YGGCCR 1 cut(s) 251
Eco31I GGTCTC 1 cut(s) 236
Eco47I GGWCC 1 cut(s) 410
Eco47III AGCGCT 1 cut(s) 261
Eco81I CCTNAGG 1 cut(s) 327
FaeI CATG 3 cut(s) 97, 433, 526
FatI CATG 3 cut(s) 93, 429, 522
Fnu4HI GCNGC 2 cut(s) 48, 263
Fsp4HI GCNGC 2 cut(s) 48, 263
GlaI GCGC 3 cut(s) 6, 40, 261
GluI GCNGC 2 cut(s) 48, 263
HaeII RGCGCY 2 cut(s) 8, 263
HaeIII GGCC 3 cut(s) 253, 377, 428
HhaI GCGC 3 cut(s) 7, 41, 262
Hin1II CATG 3 cut(s) 97, 433, 526
Hin6I GCGC 3 cut(s) 5, 39, 260
HinP1I GCGC 3 cut(s) 5, 39, 260
HincII GTYRAC 1 cut(s) 294
HindII GTYRAC 1 cut(s) 294
HinfI GANTC 3 cut(s) 82, 272, 417
Hpy166II GTNNAC 1 cut(s) 294
Hpy188I TCNGA 3 cut(s) 81, 208, 288
Hpy188III TCNNGA 1 cut(s) 319
Hpy8I GTNNAC 1 cut(s) 294
HpyCH4III ACNGT 1 cut(s) 298
HpyCH4V TGCA 1 cut(s) 47
HpyF10VI GCNNNNNNNGC 2 cut(s) 47, 259
HpyF3I CTNAG 4 cut(s) 207, 327, 492, 533
Hsp92II CATG 3 cut(s) 97, 433, 526
HspAI GCGC 3 cut(s) 5, 39, 260
Kzo9I GATC 2 cut(s) 488, 541
LmnI GCTCC 2 cut(s) 104, 359
LpnPI CCDG 6 cut(s) 111, 152, 235, 261, 339, 393
Lsp1109I GCAGC 2 cut(s) 59, 249
LweI GCATC 1 cut(s) 469
MaeIII GTNAC 1 cut(s) 469
MalI GATC 2 cut(s) 490, 543
MboI GATC 2 cut(s) 488, 541
MflI RGATCY 2 cut(s) 488, 541
MhlI GDGCHC 1 cut(s) 109
MlsI TGGCCA 1 cut(s) 253
MluCI AATT 5 cut(s) 165, 239, 332, 336, 354
MluNI TGGCCA 1 cut(s) 253
MlyI GAGTC 1 cut(s) 76
MmeI TCCRAC 1 cut(s) 82
Mox20I TGGCCA 1 cut(s) 253
MroXI GAANNNNTTC 1 cut(s) 336
MscI TGGCCA 1 cut(s) 253
MseI TTAA 1 cut(s) 335
Msp20I TGGCCA 1 cut(s) 253
MvnI CGCG 1 cut(s) 39
MwoI GCNNNNNNNGC 2 cut(s) 47, 259
NdeII GATC 2 cut(s) 488, 541
NlaIII CATG 3 cut(s) 97, 433, 526
NspI RCATGY 1 cut(s) 526
PcsI WCGNNNNNNNCGW 1 cut(s) 442
PdmI GAANNNNTTC 1 cut(s) 336
PfeI GAWTC 2 cut(s) 272, 417
PkrI GCNGC 2 cut(s) 49, 264
PleI GAGTC 1 cut(s) 76
PpsI GAGTC 1 cut(s) 76
PshBI ATTAAT 1 cut(s) 335
PsiI TTATAA 1 cut(s) 371
PspPI GGNCC 2 cut(s) 376, 410
PstNI CAGNNNCTG 1 cut(s) 499
PsuI RGATCY 2 cut(s) 488, 541
RsaI GTAC 1 cut(s) 439
RsaNI GTAC 1 cut(s) 438
SaqAI TTAA 1 cut(s) 335
SatI GCNGC 2 cut(s) 48, 263
Sau3AI GATC 2 cut(s) 488, 541
Sau96I GGNCC 2 cut(s) 376, 410
SchI GAGTC 1 cut(s) 76
SduI GDGCHC 1 cut(s) 109
SfaNI GCATC 1 cut(s) 469
SinI GGWCC 1 cut(s) 410
SmlI CTYRAG 1 cut(s) 143
SmoI CTYRAG 1 cut(s) 143
Sse9I AATT 5 cut(s) 165, 239, 332, 336, 354
TaaI ACNGT 1 cut(s) 298
TaqI TCGA 4 cut(s) 15, 196, 300, 420
TasI AATT 5 cut(s) 165, 239, 332, 336, 354
TfiI GAWTC 2 cut(s) 272, 417
Tru1I TTAA 1 cut(s) 335
Tru9I TTAA 1 cut(s) 335
TscAI CASTG 1 cut(s) 412
TseI GCWGC 2 cut(s) 47, 262
TspDTI ATGAA 2 cut(s) 82, 260
TspRI CASTG 1 cut(s) 412
VpaK11BI GGWCC 1 cut(s) 410
VspI ATTAAT 1 cut(s) 335
XapI RAATTY 1 cut(s) 239
XceI RCATGY 1 cut(s) 526
XcmI CCANNNNNNNNNTGG 2 cut(s) 167, 353
XmnI GAANNNNTTC 1 cut(s) 336
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.