Rmu_sc0000435.1_g000026

Helicase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000435.1
Physical Location & Seq
Forward (+)
110339 .. 110695
357 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000435.1_g000026.1.cds

Sequence Viewer

Length: 357 bp
atggacagatgggttagcgacagtgcatctttctatttgctatgcattagccgtagatatgacattattatcttgaattctaacctgtgtcaagattttgcgcaggttgtctttgatacattaaggaaatttgatggcaaggaatttagacaactactaccaggagaatacactcaaatggcaggccgtgctggcaggagaggacttgataaaattggtacagttattgtaatgtgccgtgatgaaatcctagaagagagggcgggatatgaagcatgtcatagttggaagtgcaaccaggctagaatctcagtttcggcttacttatattatgatcatgcatcttcttcgtgttga

Protein Analysis

118

Amino Acids

13.61

Weight (kDa)

6.7

Isoelectric Point (pI)

51.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022762)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0068041
rosa_multiflora Rmu_sc0000435.1_g000026
rosa_samantha Rh5BG463900 Rh5CG485900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 102
Acc36I ACCTGC 1 cut(s) 94
AciI CCGC 1 cut(s) 263
AcsI RAATTY 3 cut(s) 76, 128, 143
AfaI GTAC 1 cut(s) 220
AgsI TTSAA 1 cut(s) 76
AjnI CCWGG 2 cut(s) 160, 297
AoxI GGCC 1 cut(s) 184
ApoI RAATTY 3 cut(s) 76, 128, 143
AspLEI GCGC 1 cut(s) 103
BccI CCATC 2 cut(s) 3, 128
BceAI ACGGC 3 cut(s) 36, 171, 222
BcgI CGANNNNNNTGC 1 cut(s) 330
BciT130I CCWGG 2 cut(s) 162, 299
BclI TGATCA 1 cut(s) 334
BfaI CTAG 2 cut(s) 251, 303
BfuAI ACCTGC 1 cut(s) 94
BglI GCCNNNNNGGC 1 cut(s) 192
Bme1390I CCNGG 2 cut(s) 162, 299
BmrFI CCNGG 2 cut(s) 162, 299
BmsI GCATC 2 cut(s) 35, 350
BseBI CCWGG 2 cut(s) 162, 299
BseMII CTCAG 1 cut(s) 324
BshFI GGCC 1 cut(s) 186
BsnI GGCC 1 cut(s) 186
Bsp143I GATC 1 cut(s) 334
BspACI CCGC 1 cut(s) 263
BspANI GGCC 1 cut(s) 186
BspCNI CTCAG 1 cut(s) 323
BspMI ACCTGC 1 cut(s) 94
BssMI GATC 1 cut(s) 334
Bst2UI CCWGG 2 cut(s) 162, 299
Bst4CI ACNGT 2 cut(s) 23, 223
Bst6I CTCTTC 1 cut(s) 249
BstAPI GCANNNNNTGC 1 cut(s) 188
BstC8I GCNNGC 2 cut(s) 184, 193
BstDEI CTNAG 1 cut(s) 310
BstHHI GCGC 1 cut(s) 103
BstKTI GATC 1 cut(s) 337
BstMBI GATC 1 cut(s) 334
BstMWI GCNNNNNNNGC 2 cut(s) 188, 192
BstNI CCWGG 2 cut(s) 162, 299
BstNSI RCATGY 1 cut(s) 279
BstSCI CCNGG 2 cut(s) 160, 297
BsuRI GGCC 1 cut(s) 186
BtsIMutI CAGTG 1 cut(s) 28
BveI ACCTGC 1 cut(s) 94
Cac8I GCNNGC 2 cut(s) 184, 193
CfoI GCGC 1 cut(s) 103
Csp6I GTAC 1 cut(s) 219
CviAII CATG 2 cut(s) 276, 338
CviJI RGCY 4 cut(s) 51, 186, 302, 320
CviKI_1 RGCY 4 cut(s) 51, 186, 302, 320
CviQI GTAC 1 cut(s) 219
DdeI CTNAG 1 cut(s) 310
DpnI GATC 1 cut(s) 336
DpnII GATC 1 cut(s) 334
Eam1104I CTCTTC 1 cut(s) 249
EarI CTCTTC 1 cut(s) 249
EcoRI GAATTC 1 cut(s) 76
EcoRII CCWGG 2 cut(s) 160, 297
EcoT22I ATGCAT 2 cut(s) 47, 343
FaeI CATG 2 cut(s) 279, 341
FaiI YATR 8 cut(s) 43, 60, 270, 277, 282, 328, 333, 339
FatI CATG 2 cut(s) 275, 337
FauI CCCGC 1 cut(s) 256
FbaI TGATCA 1 cut(s) 334
FspBI CTAG 2 cut(s) 251, 303
FspI TGCGCA 1 cut(s) 102
GlaI GCGC 1 cut(s) 102
HaeIII GGCC 1 cut(s) 186
HhaI GCGC 1 cut(s) 103
Hin1II CATG 2 cut(s) 279, 341
Hin6I GCGC 1 cut(s) 101
HinP1I GCGC 1 cut(s) 101
HinfI GANTC 1 cut(s) 306
Hpy188III TCNNGA 2 cut(s) 73, 92
HpyCH4III ACNGT 2 cut(s) 23, 223
HpyCH4V TGCA 4 cut(s) 26, 45, 294, 341
HpyF10VI GCNNNNNNNGC 2 cut(s) 188, 192
HpyF3I CTNAG 1 cut(s) 310
Hsp92II CATG 2 cut(s) 279, 341
HspAI GCGC 1 cut(s) 101
Ksp22I TGATCA 1 cut(s) 334
Kzo9I GATC 1 cut(s) 334
LpnPI CCDG 9 cut(s) 89, 98, 147, 168, 174, 177, 181, 284, 311
LweI GCATC 2 cut(s) 35, 350
MaeI CTAG 2 cut(s) 251, 303
MalI GATC 1 cut(s) 336
MboI GATC 1 cut(s) 334
MboII GAAGA 3 cut(s) 266, 336, 339
MluCI AATT 4 cut(s) 76, 128, 143, 213
MmeI TCCRAC 1 cut(s) 266
MnlI CCTC 2 cut(s) 194, 252
Mph1103I ATGCAT 2 cut(s) 47, 343
MseI TTAA 1 cut(s) 122
MslI CAYNNNNRTG 1 cut(s) 176
MspR9I CCNGG 2 cut(s) 162, 299
MvaI CCWGG 2 cut(s) 162, 299
MwoI GCNNNNNNNGC 2 cut(s) 188, 192
NdeII GATC 1 cut(s) 334
NlaIII CATG 2 cut(s) 279, 341
NsbI TGCGCA 1 cut(s) 102
NsiI ATGCAT 2 cut(s) 47, 343
NspI RCATGY 1 cut(s) 279
PfeI GAWTC 1 cut(s) 306
Psp6I CCWGG 2 cut(s) 160, 297
PspGI CCWGG 2 cut(s) 160, 297
RsaI GTAC 1 cut(s) 220
RsaNI GTAC 1 cut(s) 219
RseI CAYNNNNRTG 1 cut(s) 176
SaqAI TTAA 1 cut(s) 122
Sau3AI GATC 1 cut(s) 334
ScrFI CCNGG 2 cut(s) 162, 299
SetI ASST 2 cut(s) 87, 108
SfaNI GCATC 2 cut(s) 35, 350
SmiMI CAYNNNNRTG 1 cut(s) 176
Sse9I AATT 4 cut(s) 76, 128, 143, 213
SsiI CCGC 1 cut(s) 263
SspMI CTAG 2 cut(s) 251, 303
StyD4I CCNGG 2 cut(s) 160, 297
TaaI ACNGT 2 cut(s) 23, 223
TasI AATT 4 cut(s) 76, 128, 143, 213
TfiI GAWTC 1 cut(s) 306
Tru1I TTAA 1 cut(s) 122
Tru9I TTAA 1 cut(s) 122
TscAI CASTG 1 cut(s) 28
TspDTI ATGAA 2 cut(s) 258, 285
TspRI CASTG 1 cut(s) 28
XapI RAATTY 3 cut(s) 76, 128, 143
XceI RCATGY 1 cut(s) 279
XspI CTAG 2 cut(s) 251, 303
Zsp2I ATGCAT 2 cut(s) 47, 343
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.