Rmu_sc0001118.1_g000020

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001118.1
OG0022876
Physical Location & Seq
Forward (+)
129235 .. 129759
525 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001118.1_g000020.1.cds

Sequence Viewer

Length: 525 bp
atgccttctcctttgttcacggttgctaataagattgaggaatctcttcctcggagtttcggtcccttttatgataagtttatagaccaatgtggaattgataagactcgtttctcgatcactgcgtttgtgaaatttgcagttaatcgtagcaatggactagctactcaacttaagctagcggaattctgtacccaagaaggattgatgtttgtttcggatgcatgccctttcctaaaaaatgcatggttgccagatgatttggtaattttcaagacttctcacgttattccacagttgattgggaagtggaaattcttagagagcttggttttgggatttgggatgttggacatcatggaccagtatgaaatggatggtaagcctgattttttgagtggacatttcggggaggttttaacgttgaaaaatttcgtctgccttgaggttttgcatgaaattgtagtgcaaattggcgctcactgcaagcgctttacggatttaacggtttatcatatatactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

174

Amino Acids

19.8

Weight (kDa)

5.69

Isoelectric Point (pI)

37.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022876)

Species Orthologous Gene IDs
rosa_laevigata RLG00000005916
rosa_multiflora Rmu_sc0001118.1_g000020
rosa_samantha Rh4CG430300 Rh4DG411400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 182
AclI AACGTT 1 cut(s) 422
AcsI RAATTY 4 cut(s) 134, 185, 314, 430
AfaI GTAC 1 cut(s) 193
AfeI AGCGCT 1 cut(s) 491
AflII CTTAAG 1 cut(s) 173
AgsI TTSAA 2 cut(s) 274, 427
AluBI AGCT 3 cut(s) 164, 178, 327
AluI AGCT 3 cut(s) 164, 178, 327
Aor51HI AGCGCT 1 cut(s) 491
ApoI RAATTY 4 cut(s) 134, 185, 314, 430
Asp700I GAANNNNTTC 2 cut(s) 45, 431
AspLEI GCGC 2 cut(s) 479, 492
AspS9I GGNCC 2 cut(s) 62, 361
AsuNHI GCTAGC 1 cut(s) 178
AvaII GGWCC 2 cut(s) 62, 361
BccI CCATC 1 cut(s) 371
BfaI CTAG 3 cut(s) 161, 179, 523
BfoI RGCGCY 2 cut(s) 480, 493
BfrI CTTAAG 1 cut(s) 173
Bme18I GGWCC 2 cut(s) 62, 361
BmgT120I GGNCC 2 cut(s) 62, 361
BmiI GGNNCC 1 cut(s) 64
BmsI GCATC 1 cut(s) 211
BmtI GCTAGC 1 cut(s) 182
BpuEI CTTGAG 1 cut(s) 464
BsaJI CCNNGG 1 cut(s) 50
BsaXI ACNNNNNCTCC 2 cut(s) 46, 76
Bse1I ACTGG 1 cut(s) 364
Bse3DI GCAATG 1 cut(s) 160
BseDI CCNNGG 1 cut(s) 50
BseGI GGATG 3 cut(s) 226, 351, 382
BseMI GCAATG 1 cut(s) 160
BseNI ACTGG 1 cut(s) 364
BslFI GGGAC 1 cut(s) 48
BsmFI GGGAC 1 cut(s) 48
Bsp143I GATC 1 cut(s) 117
BspACI CCGC 1 cut(s) 182
BspLI GGNNCC 1 cut(s) 64
BspOI GCTAGC 1 cut(s) 182
BspTI CTTAAG 1 cut(s) 173
BsrDI GCAATG 1 cut(s) 160
BsrI ACTGG 1 cut(s) 364
BssECI CCNNGG 1 cut(s) 50
BssMI GATC 1 cut(s) 117
Bst4CI ACNGT 3 cut(s) 22, 297, 508
Bst6I CTCTTC 1 cut(s) 51
BstAFI CTTAAG 1 cut(s) 173
BstC8I GCNNGC 3 cut(s) 180, 226, 488
BstDEI CTNAG 1 cut(s) 319
BstF5I GGATG 3 cut(s) 226, 351, 382
BstH2I RGCGCY 2 cut(s) 480, 493
BstHHI GCGC 2 cut(s) 479, 492
BstKTI GATC 1 cut(s) 120
BstMBI GATC 1 cut(s) 117
BstMWI GCNNNNNNNGC 1 cut(s) 483
BstNSI RCATGY 1 cut(s) 228
BtsCI GGATG 3 cut(s) 226, 351, 382
BtsI GCAGTG 2 cut(s) 120, 481
BtsIMutI CAGTG 2 cut(s) 120, 481
Cac8I GCNNGC 3 cut(s) 180, 226, 488
CfoI GCGC 2 cut(s) 479, 492
Cfr13I GGNCC 2 cut(s) 62, 361
Csp6I GTAC 1 cut(s) 192
CviAII CATG 4 cut(s) 225, 246, 358, 455
CviJI RGCY 4 cut(s) 164, 178, 327, 385
CviKI_1 RGCY 4 cut(s) 164, 178, 327, 385
CviQI GTAC 1 cut(s) 192
DdeI CTNAG 1 cut(s) 319
DpnI GATC 1 cut(s) 119
DpnII GATC 1 cut(s) 117
Eam1104I CTCTTC 1 cut(s) 51
EarI CTCTTC 1 cut(s) 51
Eco47I GGWCC 2 cut(s) 62, 361
Eco47III AGCGCT 1 cut(s) 491
EcoRI GAATTC 1 cut(s) 185
EcoT22I ATGCAT 2 cut(s) 226, 247
FaeI CATG 4 cut(s) 228, 249, 361, 458
FaqI GGGAC 1 cut(s) 48
FatI CATG 4 cut(s) 224, 245, 357, 454
FokI GGATG 3 cut(s) 233, 358, 389
FspBI CTAG 3 cut(s) 161, 179, 523
GlaI GCGC 2 cut(s) 478, 491
HaeII RGCGCY 2 cut(s) 480, 493
HhaI GCGC 2 cut(s) 479, 492
Hin1II CATG 4 cut(s) 228, 249, 361, 458
Hin6I GCGC 2 cut(s) 477, 490
HinP1I GCGC 2 cut(s) 477, 490
HinfI GANTC 2 cut(s) 41, 106
Hpy166II GTNNAC 2 cut(s) 18, 401
Hpy188I TCNGA 2 cut(s) 54, 220
Hpy188III TCNNGA 2 cut(s) 115, 274
Hpy8I GTNNAC 2 cut(s) 18, 401
HpyAV CCTTC 2 cut(s) 15, 194
HpyCH4III ACNGT 3 cut(s) 22, 297, 508
HpyCH4IV ACGT 2 cut(s) 285, 422
HpyCH4V TGCA 6 cut(s) 140, 224, 245, 454, 469, 486
HpyF10VI GCNNNNNNNGC 1 cut(s) 483
HpyF3I CTNAG 1 cut(s) 319
HpySE526I ACGT 2 cut(s) 285, 422
Hsp92II CATG 4 cut(s) 228, 249, 361, 458
HspAI GCGC 2 cut(s) 477, 490
Kzo9I GATC 1 cut(s) 117
LpnPI CCDG 3 cut(s) 267, 377, 399
LweI GCATC 1 cut(s) 211
MaeI CTAG 3 cut(s) 161, 179, 523
MaeII ACGT 2 cut(s) 285, 422
MalI GATC 1 cut(s) 119
MboI GATC 1 cut(s) 117
MboII GAAGA 1 cut(s) 38
MluCI AATT 8 cut(s) 96, 134, 185, 267, 314, 430, 459, 471
MlyI GAGTC 1 cut(s) 100
MmeI TCCRAC 1 cut(s) 330
MnlI CCTC 4 cut(s) 31, 60, 406, 439
Mph1103I ATGCAT 2 cut(s) 226, 247
MroXI GAANNNNTTC 2 cut(s) 45, 431
MseI TTAA 4 cut(s) 144, 174, 419, 503
MspCI CTTAAG 1 cut(s) 173
MwoI GCNNNNNNNGC 1 cut(s) 483
NdeII GATC 1 cut(s) 117
NheI GCTAGC 1 cut(s) 178
NlaIII CATG 4 cut(s) 228, 249, 361, 458
NlaIV GGNNCC 1 cut(s) 64
NsiI ATGCAT 2 cut(s) 226, 247
NspI RCATGY 1 cut(s) 228
PaeI GCATGC 1 cut(s) 228
PcsI WCGNNNNNNNCGW 1 cut(s) 122
PdmI GAANNNNTTC 2 cut(s) 45, 431
PfeI GAWTC 1 cut(s) 41
PleI GAGTC 1 cut(s) 100
PpsI GAGTC 1 cut(s) 100
Psp1406I AACGTT 1 cut(s) 422
PspN4I GGNNCC 1 cut(s) 64
PspPI GGNCC 2 cut(s) 62, 361
RsaI GTAC 1 cut(s) 193
RsaNI GTAC 1 cut(s) 192
SaqAI TTAA 4 cut(s) 144, 174, 419, 503
Sau3AI GATC 1 cut(s) 117
Sau96I GGNCC 2 cut(s) 62, 361
SchI GAGTC 1 cut(s) 100
SetI ASST 7 cut(s) 166, 180, 288, 329, 417, 425, 450
SfaNI GCATC 1 cut(s) 211
SinI GGWCC 2 cut(s) 62, 361
SmlI CTYRAG 2 cut(s) 173, 443
SmoI CTYRAG 2 cut(s) 173, 443
SphI GCATGC 1 cut(s) 228
Sse9I AATT 8 cut(s) 96, 134, 185, 267, 314, 430, 459, 471
SsiI CCGC 1 cut(s) 182
SspMI CTAG 3 cut(s) 161, 179, 523
TaaI ACNGT 3 cut(s) 22, 297, 508
TaiI ACGT 2 cut(s) 288, 425
TaqI TCGA 1 cut(s) 116
TaqII GACCGA 1 cut(s) 50
TasI AATT 8 cut(s) 96, 134, 185, 267, 314, 430, 459, 471
TfiI GAWTC 1 cut(s) 41
Tru1I TTAA 4 cut(s) 144, 174, 419, 503
Tru9I TTAA 4 cut(s) 144, 174, 419, 503
TscAI CASTG 2 cut(s) 127, 488
TspDTI ATGAA 2 cut(s) 384, 471
TspGWI ACGGA 1 cut(s) 512
TspRI CASTG 2 cut(s) 127, 488
Vha464I CTTAAG 1 cut(s) 173
VpaK11BI GGWCC 2 cut(s) 62, 361
XapI RAATTY 4 cut(s) 134, 185, 314, 430
XceI RCATGY 1 cut(s) 228
XmnI GAANNNNTTC 2 cut(s) 45, 431
XspI CTAG 3 cut(s) 161, 179, 523
Zsp2I ATGCAT 2 cut(s) 226, 247
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.