Rmu_sc0001534.1_g000006

receptor-like protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001534.1
Physical Location & Seq
Reverse (-)
17285 .. 17611
327 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001534.1_g000006.1.cds

Sequence Viewer

Length: 327 bp
atggagacaagacatttgtcaatgcacagaactatcgaagattttctgtactatggtagcaactttgtgccaataaggtattcttactcagaaattaagaagatgtccaacaatttcaagaacgagctgggtgaaggaggctatggctctgtatttagaggagtattacgtagtggccgttttggagccattaagatgtctgggaaattccaaatcaaatggacaagattttgtgagcaaagtggctacaattggaaggatttacaatgtatgtcaatgcggtgcaacttgttggttattgtcttgagggatcaaaacgtgctctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

108

Amino Acids

12.71

Weight (kDa)

9.58

Isoelectric Point (pI)

49.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018471)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 280
AclWI GGATC 1 cut(s) 318
AcoI YGGCCR 1 cut(s) 175
AcsI RAATTY 1 cut(s) 206
AfaI GTAC 1 cut(s) 50
AgsI TTSAA 1 cut(s) 118
AjuI GAANNNNNNNTTGG 2 cut(s) 64, 96
AluBI AGCT 1 cut(s) 127
AluI AGCT 1 cut(s) 127
Alw21I GWGCWC 1 cut(s) 324
AlwI GGATC 1 cut(s) 318
AoxI GGCC 1 cut(s) 175
ApoI RAATTY 1 cut(s) 206
ArsI GACNNNNNNTTYG 1 cut(s) 30
Asp700I GAANNNNTTC 1 cut(s) 42
AsuHPI GGTGA 1 cut(s) 143
Bbv12I GWGCWC 1 cut(s) 324
BceAI ACGGC 1 cut(s) 162
BfaI CTAG 1 cut(s) 325
BmiI GGNNCC 1 cut(s) 187
BoxI GACNNNNGTC 1 cut(s) 16
BpuEI CTTGAG 1 cut(s) 325
BsaAI YACGTR 1 cut(s) 170
BseMII CTCAG 1 cut(s) 102
BseRI GAGGAG 1 cut(s) 174
BseYI CCCAGC 1 cut(s) 127
BshFI GGCC 1 cut(s) 177
BsiHKAI GWGCWC 1 cut(s) 324
BsnI GGCC 1 cut(s) 177
Bsp1286I GDGCHC 1 cut(s) 324
Bsp143I GATC 1 cut(s) 310
BspACI CCGC 1 cut(s) 280
BspANI GGCC 1 cut(s) 177
BspCNI CTCAG 1 cut(s) 101
BspLI GGNNCC 1 cut(s) 187
BspPI GGATC 1 cut(s) 318
BssMI GATC 1 cut(s) 310
BstBAI YACGTR 1 cut(s) 170
BstDEI CTNAG 1 cut(s) 88
BstKTI GATC 1 cut(s) 313
BstMBI GATC 1 cut(s) 310
BstPAI GACNNNNGTC 1 cut(s) 16
BstSNI TACGTA 1 cut(s) 170
BsuRI GGCC 1 cut(s) 177
Csp6I GTAC 1 cut(s) 49
CviJI RGCY 6 cut(s) 127, 141, 147, 177, 188, 246
CviKI_1 RGCY 6 cut(s) 127, 141, 147, 177, 188, 246
CviQI GTAC 1 cut(s) 49
DdeI CTNAG 1 cut(s) 88
DpnI GATC 1 cut(s) 312
DpnII GATC 1 cut(s) 310
EaeI YGGCCR 1 cut(s) 175
Eco105I TACGTA 1 cut(s) 170
FaiI YATR 3 cut(s) 54, 144, 272
FalI AAGNNNNNCTT 2 cut(s) 67, 99
FspBI CTAG 1 cut(s) 325
GsaI CCCAGC 1 cut(s) 131
HaeIII GGCC 1 cut(s) 177
HphI GGTGA 1 cut(s) 143
Hpy188I TCNGA 1 cut(s) 91
Hpy188III TCNNGA 2 cut(s) 118, 304
HpyAV CCTTC 2 cut(s) 128, 250
HpyCH4IV ACGT 2 cut(s) 169, 318
HpyCH4V TGCA 2 cut(s) 25, 285
HpyF3I CTNAG 1 cut(s) 88
HpySE526I ACGT 2 cut(s) 169, 318
Kzo9I GATC 1 cut(s) 310
LmnI GCTCC 1 cut(s) 185
LpnPI CCDG 2 cut(s) 113, 186
MaeI CTAG 1 cut(s) 325
MaeII ACGT 2 cut(s) 169, 318
MalI GATC 1 cut(s) 312
MboI GATC 1 cut(s) 310
MboII GAAGA 2 cut(s) 50, 112
MfeI CAATTG 1 cut(s) 250
MhlI GDGCHC 1 cut(s) 324
MluCI AATT 4 cut(s) 93, 112, 206, 250
MmeI TCCRAC 1 cut(s) 132
MnlI CCTC 3 cut(s) 131, 152, 300
MroXI GAANNNNTTC 1 cut(s) 42
MseI TTAA 2 cut(s) 96, 192
MslI CAYNNNNRTG 1 cut(s) 194
MunI CAATTG 1 cut(s) 250
NdeII GATC 1 cut(s) 310
NlaIV GGNNCC 1 cut(s) 187
PcsI WCGNNNNNNNCGW 1 cut(s) 175
PdmI GAANNNNTTC 1 cut(s) 42
Ppu21I YACGTR 1 cut(s) 170
PshAI GACNNNNGTC 1 cut(s) 16
PspFI CCCAGC 1 cut(s) 127
PspN4I GGNNCC 1 cut(s) 187
RsaI GTAC 1 cut(s) 50
RsaNI GTAC 1 cut(s) 49
RseI CAYNNNNRTG 1 cut(s) 194
SaqAI TTAA 2 cut(s) 96, 192
Sau3AI GATC 1 cut(s) 310
SduI GDGCHC 1 cut(s) 324
SetI ASST 4 cut(s) 80, 129, 172, 321
SgeI CNNG 8 cut(s) 21, 130, 136, 140, 213, 237, 301, 316
SmiMI CAYNNNNRTG 1 cut(s) 194
SmlI CTYRAG 1 cut(s) 304
SmoI CTYRAG 1 cut(s) 304
SnaBI TACGTA 1 cut(s) 170
Sse9I AATT 4 cut(s) 93, 112, 206, 250
SsiI CCGC 1 cut(s) 280
SspMI CTAG 1 cut(s) 325
TaiI ACGT 2 cut(s) 172, 321
TaqI TCGA 1 cut(s) 36
TasI AATT 4 cut(s) 93, 112, 206, 250
TatI WGTACW 1 cut(s) 48
Tru1I TTAA 2 cut(s) 96, 192
Tru9I TTAA 2 cut(s) 96, 192
XapI RAATTY 1 cut(s) 206
XmnI GAANNNNTTC 1 cut(s) 42
XspI CTAG 1 cut(s) 325
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.