Rmu_sc0001606.1_g000004

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001606.1
OG0025457
Physical Location & Seq
Reverse (-)
14146 .. 14512
367 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001606.1_g000004.1.cds

Sequence Viewer

Length: 291 bp
atgacccgtgtcaatgaccagaggcacgaacccttatcttcccaagtactcgaactgaatgcccgtaatctcgccatagctcagcttcttcaaacctggagctctgacaacgacgggaaccagctgtatgtgtactcgcttcaccttcccgattttgccagtagtgcttccctccaagggaattggtttgatctggagaggctgaatcggctcgatctcagttctaacaacttcaccagctcaatcccatttgcggtcaacaatctcacgcagagagatgagattggttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

96

Amino Acids

10.89

Weight (kDa)

4.64

Isoelectric Point (pI)

30.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025457)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0001606.1_g000004 Rmu_ssc0000174.1_g000034
rosa_roxburghii Rroxscaffold_6G00409350

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 254
AfaI GTAC 2 cut(s) 48, 134
AfiI CCNNNNNNNGG 2 cut(s) 177, 253
AgsI TTSAA 1 cut(s) 92
AjnI CCWGG 1 cut(s) 95
AluBI AGCT 5 cut(s) 80, 85, 102, 124, 240
AluI AGCT 5 cut(s) 80, 85, 102, 124, 240
Alw21I GWGCWC 1 cut(s) 104
AsuHPI GGTGA 2 cut(s) 134, 226
BanII GRGCYC 1 cut(s) 104
Bbv12I GWGCWC 1 cut(s) 104
BcgI CGANNNNNNTGC 2 cut(s) 41, 75
BciT130I CCWGG 1 cut(s) 97
BlpI GCTNAGC 1 cut(s) 81
BmcAI AGTACT 1 cut(s) 48
Bme1390I CCNGG 1 cut(s) 97
BmiI GGNNCC 1 cut(s) 119
BmrFI CCNGG 1 cut(s) 97
BoxI GACNNNNGTC 1 cut(s) 8
BpmI CTGGAG 2 cut(s) 118, 215
Bpu1102I GCTNAGC 1 cut(s) 81
BsaJI CCNNGG 1 cut(s) 175
Bsc4I CCNNNNNNNGG 2 cut(s) 177, 253
Bse1I ACTGG 1 cut(s) 159
BseBI CCWGG 1 cut(s) 97
BseDI CCNNGG 1 cut(s) 175
BseLI CCNNNNNNNGG 2 cut(s) 177, 253
BseMII CTCAG 2 cut(s) 95, 232
BseNI ACTGG 1 cut(s) 159
BsiHKAI GWGCWC 1 cut(s) 104
BslI CCNNNNNNNGG 2 cut(s) 177, 253
BsmI GAATGC 1 cut(s) 64
Bsp1286I GDGCHC 1 cut(s) 104
Bsp143I GATC 2 cut(s) 190, 214
Bsp1720I GCTNAGC 1 cut(s) 81
BspACI CCGC 1 cut(s) 254
BspCNI CTCAG 2 cut(s) 94, 231
BspLI GGNNCC 1 cut(s) 119
BsrI ACTGG 1 cut(s) 159
BssECI CCNNGG 1 cut(s) 175
BssMI GATC 2 cut(s) 190, 214
BssT1I CCWWGG 1 cut(s) 175
Bst2UI CCWGG 1 cut(s) 97
BstDEI CTNAG 2 cut(s) 81, 218
BstKTI GATC 2 cut(s) 193, 217
BstMBI GATC 2 cut(s) 190, 214
BstMWI GCNNNNNNNGC 2 cut(s) 164, 208
BstNI CCWGG 1 cut(s) 97
BstPAI GACNNNNGTC 1 cut(s) 8
BstSCI CCNGG 1 cut(s) 95
Csp6I GTAC 2 cut(s) 47, 133
CviJI RGCY 7 cut(s) 80, 85, 102, 124, 202, 211, 240
CviKI_1 RGCY 7 cut(s) 80, 85, 102, 124, 202, 211, 240
CviQI GTAC 2 cut(s) 47, 133
DdeI CTNAG 2 cut(s) 81, 218
DpnI GATC 2 cut(s) 192, 216
DpnII GATC 2 cut(s) 190, 214
Ecl136II GAGCTC 1 cut(s) 102
Eco130I CCWWGG 1 cut(s) 175
Eco24I GRGCYC 1 cut(s) 104
Eco53kI GAGCTC 1 cut(s) 102
EcoICRI GAGCTC 1 cut(s) 102
EcoRII CCWGG 1 cut(s) 95
EcoT14I CCWWGG 1 cut(s) 175
EcoT38I GRGCYC 1 cut(s) 104
ErhI CCWWGG 1 cut(s) 175
FaiI YATR 2 cut(s) 77, 129
FriOI GRGCYC 1 cut(s) 104
GsuI CTGGAG 2 cut(s) 118, 215
HincII GTYRAC 1 cut(s) 259
HindII GTYRAC 1 cut(s) 259
HinfI GANTC 1 cut(s) 205
HphI GGTGA 2 cut(s) 134, 226
Hpy166II GTNNAC 2 cut(s) 133, 259
Hpy188I TCNGA 1 cut(s) 106
Hpy188III TCNNGA 2 cut(s) 149, 194
Hpy8I GTNNAC 2 cut(s) 133, 259
Hpy99I CGWCG 1 cut(s) 116
HpyAV CCTTC 1 cut(s) 155
HpyF10VI GCNNNNNNNGC 2 cut(s) 164, 208
HpyF3I CTNAG 2 cut(s) 81, 218
Kzo9I GATC 2 cut(s) 190, 214
LmnI GCTCC 1 cut(s) 99
LpnPI CCDG 7 cut(s) 32, 82, 109, 134, 172, 179, 250
MalI GATC 2 cut(s) 192, 216
MboI GATC 2 cut(s) 190, 214
MboII GAAGA 2 cut(s) 30, 80
MhlI GDGCHC 1 cut(s) 104
MluCI AATT 1 cut(s) 181
MnlI CCTC 3 cut(s) 15, 182, 192
MspA1I CMGCKG 1 cut(s) 124
MspR9I CCNGG 1 cut(s) 97
Mva1269I GAATGC 1 cut(s) 64
MvaI CCWGG 1 cut(s) 97
MwoI GCNNNNNNNGC 2 cut(s) 164, 208
NdeII GATC 2 cut(s) 190, 214
NlaIV GGNNCC 1 cut(s) 119
PctI GAATGC 1 cut(s) 64
PfeI GAWTC 1 cut(s) 205
PshAI GACNNNNGTC 1 cut(s) 8
Psp124BI GAGCTC 1 cut(s) 104
Psp6I CCWGG 1 cut(s) 95
PspGI CCWGG 1 cut(s) 95
PspN4I GGNNCC 1 cut(s) 119
PvuII CAGCTG 1 cut(s) 124
RsaI GTAC 2 cut(s) 48, 134
RsaNI GTAC 2 cut(s) 47, 133
SacI GAGCTC 1 cut(s) 104
Sau3AI GATC 2 cut(s) 190, 214
ScaI AGTACT 1 cut(s) 48
ScrFI CCNGG 1 cut(s) 97
SduI GDGCHC 1 cut(s) 104
SetI ASST 7 cut(s) 82, 87, 98, 104, 126, 147, 242
Sse9I AATT 1 cut(s) 181
SsiI CCGC 1 cut(s) 254
SstI GAGCTC 1 cut(s) 104
StyD4I CCNGG 1 cut(s) 95
StyI CCWWGG 1 cut(s) 175
TaqI TCGA 2 cut(s) 51, 213
TasI AATT 1 cut(s) 181
TatI WGTACW 2 cut(s) 46, 132
TfiI GAWTC 1 cut(s) 205
ZrmI AGTACT 1 cut(s) 48
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.