Rmu_ssc0000174.1_g000034
NAC Family

inactive receptor kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000174.1
Physical Location & Seq
Forward (+)
168189 .. 168529
341 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000174.1_g000034.1.cds

Sequence Viewer

Length: 291 bp
atgacccgtttcaatgaccagaggcacgaacccttatcttcccaagtactcgaacagaatgcccataatctcgccatagctcagcttcttcaaacctggagtgtgtactcgcttcaccttccaggtgttgggcttgtgggtccgattccacccaacacgctcagtgctttgcttcaagggaattggctcgatctggagaggctgaatcagctcgatctcagttctaacaacttcaccggctcaatcccattcgcggtcaacaatctcacgcagagagatgagattggttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

96

Amino Acids

10.66

Weight (kDa)

5.01

Isoelectric Point (pI)

26.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0025457)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0001606.1_g000004 Rmu_ssc0000174.1_g000034
rosa_roxburghii Rroxscaffold_6G00409350

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 128
AccII CGCG 1 cut(s) 254
AciI CCGC 1 cut(s) 254
AfaI GTAC 2 cut(s) 48, 107
AfiI CCNNNNNNNGG 2 cut(s) 128, 253
AgsI TTSAA 3 cut(s) 13, 92, 176
AjnI CCWGG 2 cut(s) 95, 121
AluBI AGCT 3 cut(s) 80, 85, 211
AluI AGCT 3 cut(s) 80, 85, 211
AspS9I GGNCC 1 cut(s) 140
AsuHPI GGTGA 2 cut(s) 107, 226
AvaII GGWCC 1 cut(s) 140
BcgI CGANNNNNNTGC 2 cut(s) 41, 75
BciT130I CCWGG 2 cut(s) 97, 123
BlpI GCTNAGC 1 cut(s) 81
BmcAI AGTACT 1 cut(s) 48
Bme1390I CCNGG 2 cut(s) 97, 123
Bme18I GGWCC 1 cut(s) 140
BmgT120I GGNCC 1 cut(s) 140
BmiI GGNNCC 1 cut(s) 141
BmrFI CCNGG 2 cut(s) 97, 123
BpmI CTGGAG 2 cut(s) 118, 215
Bpu1102I GCTNAGC 1 cut(s) 81
Bsc4I CCNNNNNNNGG 2 cut(s) 128, 253
Bse118I RCCGGY 1 cut(s) 236
BseBI CCWGG 2 cut(s) 97, 123
BseLI CCNNNNNNNGG 2 cut(s) 128, 253
BseMII CTCAG 3 cut(s) 95, 175, 232
Bsh1236I CGCG 1 cut(s) 254
BsiSI CCGG 1 cut(s) 237
BslI CCNNNNNNNGG 2 cut(s) 128, 253
BsmI GAATGC 1 cut(s) 64
Bsp143I GATC 2 cut(s) 190, 214
Bsp1720I GCTNAGC 1 cut(s) 81
BspACI CCGC 1 cut(s) 254
BspCNI CTCAG 3 cut(s) 94, 174, 231
BspFNI CGCG 1 cut(s) 254
BspLI GGNNCC 1 cut(s) 141
BsrFI RCCGGY 1 cut(s) 236
BssAI RCCGGY 1 cut(s) 236
BssMI GATC 2 cut(s) 190, 214
Bst2UI CCWGG 2 cut(s) 97, 123
BstDEI CTNAG 3 cut(s) 81, 161, 218
BstFNI CGCG 1 cut(s) 254
BstKTI GATC 2 cut(s) 193, 217
BstMBI GATC 2 cut(s) 190, 214
BstMWI GCNNNNNNNGC 1 cut(s) 208
BstNI CCWGG 2 cut(s) 97, 123
BstSCI CCNGG 2 cut(s) 95, 121
BstUI CGCG 1 cut(s) 254
BtsIMutI CAGTG 1 cut(s) 169
Cfr10I RCCGGY 1 cut(s) 236
Cfr13I GGNCC 1 cut(s) 140
Csp6I GTAC 2 cut(s) 47, 106
CviJI RGCY 7 cut(s) 80, 85, 133, 187, 202, 211, 240
CviKI_1 RGCY 7 cut(s) 80, 85, 133, 187, 202, 211, 240
CviQI GTAC 2 cut(s) 47, 106
DdeI CTNAG 3 cut(s) 81, 161, 218
DpnI GATC 2 cut(s) 192, 216
DpnII GATC 2 cut(s) 190, 214
Eco47I GGWCC 1 cut(s) 140
EcoRII CCWGG 2 cut(s) 95, 121
FaiI YATR 2 cut(s) 66, 77
GsuI CTGGAG 2 cut(s) 118, 215
HapII CCGG 1 cut(s) 237
HincII GTYRAC 1 cut(s) 259
HindII GTYRAC 1 cut(s) 259
HinfI GANTC 2 cut(s) 145, 205
HpaII CCGG 1 cut(s) 237
HphI GGTGA 2 cut(s) 107, 226
Hpy166II GTNNAC 2 cut(s) 106, 259
Hpy188I TCNGA 1 cut(s) 144
Hpy188III TCNNGA 1 cut(s) 194
Hpy8I GTNNAC 2 cut(s) 106, 259
HpyAV CCTTC 1 cut(s) 128
HpyF10VI GCNNNNNNNGC 1 cut(s) 208
HpyF3I CTNAG 3 cut(s) 81, 161, 218
Kzo9I GATC 2 cut(s) 190, 214
LpnPI CCDG 7 cut(s) 32, 82, 108, 109, 135, 179, 250
MalI GATC 2 cut(s) 192, 216
MboI GATC 2 cut(s) 190, 214
MboII GAAGA 2 cut(s) 30, 80
MluCI AATT 1 cut(s) 181
MnlI CCTC 2 cut(s) 15, 192
MspI CCGG 1 cut(s) 237
MspR9I CCNGG 2 cut(s) 97, 123
Mva1269I GAATGC 1 cut(s) 64
MvaI CCWGG 2 cut(s) 97, 123
MvnI CGCG 1 cut(s) 254
MwoI GCNNNNNNNGC 1 cut(s) 208
NdeII GATC 2 cut(s) 190, 214
NlaIV GGNNCC 1 cut(s) 141
PctI GAATGC 1 cut(s) 64
PfeI GAWTC 2 cut(s) 145, 205
PflMI CCANNNNNTGG 1 cut(s) 128
Psp6I CCWGG 2 cut(s) 95, 121
PspGI CCWGG 2 cut(s) 95, 121
PspN4I GGNNCC 1 cut(s) 141
PspPI GGNCC 1 cut(s) 140
RsaI GTAC 2 cut(s) 48, 107
RsaNI GTAC 2 cut(s) 47, 106
Sau3AI GATC 2 cut(s) 190, 214
Sau96I GGNCC 1 cut(s) 140
ScaI AGTACT 1 cut(s) 48
ScrFI CCNGG 2 cut(s) 97, 123
SetI ASST 6 cut(s) 82, 87, 98, 120, 127, 213
SinI GGWCC 1 cut(s) 140
Sse9I AATT 1 cut(s) 181
SsiI CCGC 1 cut(s) 254
StyD4I CCNGG 2 cut(s) 95, 121
TaqI TCGA 3 cut(s) 51, 189, 213
TasI AATT 1 cut(s) 181
TatI WGTACW 2 cut(s) 46, 105
TfiI GAWTC 2 cut(s) 145, 205
TscAI CASTG 1 cut(s) 169
TspRI CASTG 1 cut(s) 169
Van91I CCANNNNNTGG 1 cut(s) 128
VpaK11BI GGWCC 1 cut(s) 140
ZrmI AGTACT 1 cut(s) 48
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.