Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001983.1

Orthogroup ID

OG0025161

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 4598

Gene Structure 4598 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001983.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 249 bp

gaatggtcttggattccagttggggggtcattactgaatgcagagcaaaagaatttggcatttggtgctgctgctagcatggtacatccagccacagggtactcagtagtgagatctttgtcggaggctccaaaatatgcttctgtgattgcaaagattttgaagcaggattgtcctaaggccagtcttagccgtcaaataagaaatcagaatatctcaatgcaaggcaaagccatggccttttgctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0006629 GO:0006720 GO:0006721 GO:0008150 GO:0008152 GO:0008299 GO:0008610 GO:0009058 GO:0009975 GO:0009987 GO:0016108 GO:0016109 GO:0016114 GO:0016116 GO:0016117 GO:0016122 GO:0016123 GO:0016853 GO:0016860 GO:0042440 GO:0044237 GO:0044238 GO:0044249 GO:0044255 GO:0045435 GO:0046148 GO:0071704 GO:1901576

KEGG Pathways

Metabolic & Signaling

ko00906 ko01100 ko01110 map00906 map01100 map01110

Pfam Domains

Protein Families

Lycopene_cycl

Protein Analysis

82

Amino Acids

8.82

Weight (kDa)

9.63

Isoelectric Point (pI)

42.75

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025161)

Species	Orthologous Gene IDs
rosa_laevigata	RLG00000002957
rosa_multiflora	Rmu_sc0001983.1_g000001
rosa_samantha	Rh2BG418200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	52
AfaI	GTAC	2 cut(s)	84, 101
AfiI	CCNNNNNNNGG	2 cut(s)	23, 95
AgsI	TTSAA	1 cut(s)	163
AjuI	GAANNNNNNNTTGG	2 cut(s)	124, 156
AoxI	GGCC	2 cut(s)	180, 237
ApeKI	GCWGC	2 cut(s)	68, 71
ApoI	RAATTY	1 cut(s)	52
AsuNHI	GCTAGC	1 cut(s)	74
AxyI	CCTNAGG	1 cut(s)	177
BbvI	GCAGC	2 cut(s)	55, 58
BceAI	ACGGC	1 cut(s)	177
BfaI	CTAG	1 cut(s)	75
BglII	AGATCT	1 cut(s)	113
BisI	GCNGC	2 cut(s)	69, 72
BlsI	GCNGC	2 cut(s)	70, 73
BmiI	GGNNCC	1 cut(s)	129
BmtI	GCTAGC	1 cut(s)	78
BsaJI	CCNNGG	1 cut(s)	234
Bsc4I	CCNNNNNNNGG	2 cut(s)	23, 95
Bse1I	ACTGG	2 cut(s)	17, 183
Bse21I	CCTNAGG	1 cut(s)	177
BseDI	CCNNGG	1 cut(s)	234
BseGI	GGATG	1 cut(s)	85
BseLI	CCNNNNNNNGG	2 cut(s)	23, 95
BseMII	CTCAG	1 cut(s)	117
BseNI	ACTGG	2 cut(s)	17, 183
BseXI	GCAGC	2 cut(s)	55, 58
BshFI	GGCC	2 cut(s)	182, 239
BslI	CCNNNNNNNGG	2 cut(s)	23, 95
BsmI	GAATGC	1 cut(s)	43
BsnI	GGCC	2 cut(s)	182, 239
Bsp143I	GATC	1 cut(s)	113
Bsp19I	CCATGG	1 cut(s)	234
BspANI	GGCC	2 cut(s)	182, 239
BspCNI	CTCAG	1 cut(s)	116
BspLI	GGNNCC	1 cut(s)	129
BspOI	GCTAGC	1 cut(s)	78
BsrI	ACTGG	2 cut(s)	17, 183
BssECI	CCNNGG	1 cut(s)	234
BssMI	GATC	1 cut(s)	113
BssT1I	CCWWGG	1 cut(s)	234
BstAPI	GCANNNNNTGC	1 cut(s)	65
BstC8I	GCNNGC	1 cut(s)	76
BstDEI	CTNAG	3 cut(s)	103, 177, 188
BstDSI	CCRYGG	1 cut(s)	234
BstF5I	GGATG	1 cut(s)	85
BstKTI	GATC	1 cut(s)	116
BstMBI	GATC	1 cut(s)	113
BstMWI	GCNNNNNNNGC	1 cut(s)	65
BstV1I	GCAGC	2 cut(s)	55, 58
BstX2I	RGATCY	1 cut(s)	113
BstYI	RGATCY	1 cut(s)	113
Bsu36I	CCTNAGG	1 cut(s)	177
BsuRI	GGCC	2 cut(s)	182, 239
BtgI	CCRYGG	1 cut(s)	234
BtsCI	GGATG	1 cut(s)	85
Cac8I	GCNNGC	1 cut(s)	76
Csp6I	GTAC	2 cut(s)	83, 100
CviAII	CATG	2 cut(s)	79, 235
CviJI	RGCY	6 cut(s)	92, 128, 182, 192, 233, 239
CviKI_1	RGCY	6 cut(s)	92, 128, 182, 192, 233, 239
CviQI	GTAC	2 cut(s)	83, 100
DdeI	CTNAG	3 cut(s)	103, 177, 188
DpnI	GATC	1 cut(s)	115
DpnII	GATC	1 cut(s)	113
Eco130I	CCWWGG	1 cut(s)	234
Eco81I	CCTNAGG	1 cut(s)	177
EcoT14I	CCWWGG	1 cut(s)	234
ErhI	CCWWGG	1 cut(s)	234
FaeI	CATG	2 cut(s)	82, 238
FaiI	YATR	3 cut(s)	80, 138, 236
FatI	CATG	2 cut(s)	78, 234
Fnu4HI	GCNGC	2 cut(s)	69, 72
FokI	GGATG	1 cut(s)	72
Fsp4HI	GCNGC	2 cut(s)	69, 72
FspBI	CTAG	1 cut(s)	75
GluI	GCNGC	2 cut(s)	69, 72
HaeIII	GGCC	2 cut(s)	182, 239
Hin1II	CATG	2 cut(s)	82, 238
HinfI	GANTC	1 cut(s)	13
Hpy188I	TCNGA	2 cut(s)	124, 210
HpyCH4V	TGCA	3 cut(s)	41, 152, 223
HpyF10VI	GCNNNNNNNGC	1 cut(s)	65
HpyF3I	CTNAG	3 cut(s)	103, 177, 188
Hsp92II	CATG	2 cut(s)	82, 238
Kzo9I	GATC	1 cut(s)	113
LmnI	GCTCC	1 cut(s)	133
LpnPI	CCDG	5 cut(s)	30, 81, 102, 152, 196
Lsp1109I	GCAGC	2 cut(s)	55, 58
MaeI	CTAG	1 cut(s)	75
MalI	GATC	1 cut(s)	115
MboI	GATC	1 cut(s)	113
MflI	RGATCY	1 cut(s)	113
MluCI	AATT	1 cut(s)	52
MmeI	TCCRAC	1 cut(s)	102
MnlI	CCTC	1 cut(s)	118
Mva1269I	GAATGC	1 cut(s)	43
MwoI	GCNNNNNNNGC	1 cut(s)	65
NcoI	CCATGG	1 cut(s)	234
NdeII	GATC	1 cut(s)	113
NheI	GCTAGC	1 cut(s)	74
NlaIII	CATG	2 cut(s)	82, 238
NlaIV	GGNNCC	1 cut(s)	129
PctI	GAATGC	1 cut(s)	43
PfeI	GAWTC	1 cut(s)	13
PkrI	GCNGC	2 cut(s)	70, 73
PspN4I	GGNNCC	1 cut(s)	129
PsuI	RGATCY	1 cut(s)	113
RsaI	GTAC	2 cut(s)	84, 101
RsaNI	GTAC	2 cut(s)	83, 100
SatI	GCNGC	2 cut(s)	69, 72
Sau3AI	GATC	1 cut(s)	113
SgeI	CNNG	9 cut(s)	21, 29, 87, 91, 101, 108, 179, 195, 236
Sse9I	AATT	1 cut(s)	52
SspMI	CTAG	1 cut(s)	75
StyI	CCWWGG	1 cut(s)	234
TasI	AATT	1 cut(s)	52
TfiI	GAWTC	1 cut(s)	13
TseI	GCWGC	2 cut(s)	68, 71
XapI	RAATTY	1 cut(s)	52
XspI	CTAG	1 cut(s)	75

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.