Rmu_sc0001983.1_g000001

Lycopene epsilon cyclase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001983.1
OG0025161
Physical Location & Seq
Forward (+)
1 .. 4598
4598 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 249 bp
gaatggtcttggattccagttggggggtcattactgaatgcagagcaaaagaatttggcatttggtgctgctgctagcatggtacatccagccacagggtactcagtagtgagatctttgtcggaggctccaaaatatgcttctgtgattgcaaagattttgaagcaggattgtcctaaggccagtcttagccgtcaaataagaaatcagaatatctcaatgcaaggcaaagccatggccttttgctga

Protein Analysis

82

Amino Acids

8.82

Weight (kDa)

9.63

Isoelectric Point (pI)

42.75

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Lycopene_cycl PF05834 1 - 77 1.6e-22 Lycopene cyclase protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025161)

Species Orthologous Gene IDs
rosa_laevigata RLG00000002957
rosa_multiflora Rmu_sc0001983.1_g000001
rosa_samantha Rh2BG418200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 52
AfaI GTAC 2 cut(s) 84, 101
AfiI CCNNNNNNNGG 2 cut(s) 23, 95
AgsI TTSAA 1 cut(s) 163
AjuI GAANNNNNNNTTGG 2 cut(s) 124, 156
AoxI GGCC 2 cut(s) 180, 237
ApeKI GCWGC 2 cut(s) 68, 71
ApoI RAATTY 1 cut(s) 52
AsuNHI GCTAGC 1 cut(s) 74
AxyI CCTNAGG 1 cut(s) 177
BbvI GCAGC 2 cut(s) 55, 58
BceAI ACGGC 1 cut(s) 177
BfaI CTAG 1 cut(s) 75
BglII AGATCT 1 cut(s) 113
BisI GCNGC 2 cut(s) 69, 72
BlsI GCNGC 2 cut(s) 70, 73
BmiI GGNNCC 1 cut(s) 129
BmtI GCTAGC 1 cut(s) 78
BsaJI CCNNGG 1 cut(s) 234
Bsc4I CCNNNNNNNGG 2 cut(s) 23, 95
Bse1I ACTGG 2 cut(s) 17, 183
Bse21I CCTNAGG 1 cut(s) 177
BseDI CCNNGG 1 cut(s) 234
BseGI GGATG 1 cut(s) 85
BseLI CCNNNNNNNGG 2 cut(s) 23, 95
BseMII CTCAG 1 cut(s) 117
BseNI ACTGG 2 cut(s) 17, 183
BseXI GCAGC 2 cut(s) 55, 58
BshFI GGCC 2 cut(s) 182, 239
BslI CCNNNNNNNGG 2 cut(s) 23, 95
BsmI GAATGC 1 cut(s) 43
BsnI GGCC 2 cut(s) 182, 239
Bsp143I GATC 1 cut(s) 113
Bsp19I CCATGG 1 cut(s) 234
BspANI GGCC 2 cut(s) 182, 239
BspCNI CTCAG 1 cut(s) 116
BspLI GGNNCC 1 cut(s) 129
BspOI GCTAGC 1 cut(s) 78
BsrI ACTGG 2 cut(s) 17, 183
BssECI CCNNGG 1 cut(s) 234
BssMI GATC 1 cut(s) 113
BssT1I CCWWGG 1 cut(s) 234
BstAPI GCANNNNNTGC 1 cut(s) 65
BstC8I GCNNGC 1 cut(s) 76
BstDEI CTNAG 3 cut(s) 103, 177, 188
BstDSI CCRYGG 1 cut(s) 234
BstF5I GGATG 1 cut(s) 85
BstKTI GATC 1 cut(s) 116
BstMBI GATC 1 cut(s) 113
BstMWI GCNNNNNNNGC 1 cut(s) 65
BstV1I GCAGC 2 cut(s) 55, 58
BstX2I RGATCY 1 cut(s) 113
BstYI RGATCY 1 cut(s) 113
Bsu36I CCTNAGG 1 cut(s) 177
BsuRI GGCC 2 cut(s) 182, 239
BtgI CCRYGG 1 cut(s) 234
BtsCI GGATG 1 cut(s) 85
Cac8I GCNNGC 1 cut(s) 76
Csp6I GTAC 2 cut(s) 83, 100
CviAII CATG 2 cut(s) 79, 235
CviJI RGCY 6 cut(s) 92, 128, 182, 192, 233, 239
CviKI_1 RGCY 6 cut(s) 92, 128, 182, 192, 233, 239
CviQI GTAC 2 cut(s) 83, 100
DdeI CTNAG 3 cut(s) 103, 177, 188
DpnI GATC 1 cut(s) 115
DpnII GATC 1 cut(s) 113
Eco130I CCWWGG 1 cut(s) 234
Eco81I CCTNAGG 1 cut(s) 177
EcoT14I CCWWGG 1 cut(s) 234
ErhI CCWWGG 1 cut(s) 234
FaeI CATG 2 cut(s) 82, 238
FaiI YATR 3 cut(s) 80, 138, 236
FatI CATG 2 cut(s) 78, 234
Fnu4HI GCNGC 2 cut(s) 69, 72
FokI GGATG 1 cut(s) 72
Fsp4HI GCNGC 2 cut(s) 69, 72
FspBI CTAG 1 cut(s) 75
GluI GCNGC 2 cut(s) 69, 72
HaeIII GGCC 2 cut(s) 182, 239
Hin1II CATG 2 cut(s) 82, 238
HinfI GANTC 1 cut(s) 13
Hpy188I TCNGA 2 cut(s) 124, 210
HpyCH4V TGCA 3 cut(s) 41, 152, 223
HpyF10VI GCNNNNNNNGC 1 cut(s) 65
HpyF3I CTNAG 3 cut(s) 103, 177, 188
Hsp92II CATG 2 cut(s) 82, 238
Kzo9I GATC 1 cut(s) 113
LmnI GCTCC 1 cut(s) 133
LpnPI CCDG 5 cut(s) 30, 81, 102, 152, 196
Lsp1109I GCAGC 2 cut(s) 55, 58
MaeI CTAG 1 cut(s) 75
MalI GATC 1 cut(s) 115
MboI GATC 1 cut(s) 113
MflI RGATCY 1 cut(s) 113
MluCI AATT 1 cut(s) 52
MmeI TCCRAC 1 cut(s) 102
MnlI CCTC 1 cut(s) 118
Mva1269I GAATGC 1 cut(s) 43
MwoI GCNNNNNNNGC 1 cut(s) 65
NcoI CCATGG 1 cut(s) 234
NdeII GATC 1 cut(s) 113
NheI GCTAGC 1 cut(s) 74
NlaIII CATG 2 cut(s) 82, 238
NlaIV GGNNCC 1 cut(s) 129
PctI GAATGC 1 cut(s) 43
PfeI GAWTC 1 cut(s) 13
PkrI GCNGC 2 cut(s) 70, 73
PspN4I GGNNCC 1 cut(s) 129
PsuI RGATCY 1 cut(s) 113
RsaI GTAC 2 cut(s) 84, 101
RsaNI GTAC 2 cut(s) 83, 100
SatI GCNGC 2 cut(s) 69, 72
Sau3AI GATC 1 cut(s) 113
SgeI CNNG 9 cut(s) 21, 29, 87, 91, 101, 108, 179, 195, 236
Sse9I AATT 1 cut(s) 52
SspMI CTAG 1 cut(s) 75
StyI CCWWGG 1 cut(s) 234
TasI AATT 1 cut(s) 52
TfiI GAWTC 1 cut(s) 13
TseI GCWGC 2 cut(s) 68, 71
XapI RAATTY 1 cut(s) 52
XspI CTAG 1 cut(s) 75
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.