Rmu_sc0002209.1_g000026

F-box LRR-repeat protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002209.1
OG0025527
Physical Location & Seq
Forward (+)
99831 .. 100217
387 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002209.1_g000026.1.cds

Sequence Viewer

Length: 387 bp
atgaggcctaatgcacttgctatagcaggaacaatgcataatttacgccacctccagatttttatgaataagctgactaatgatggcttgcgggctatacttgatggttgtcctccacttgagtcacttgatctgcgccagtgttacaatcttaatctggaggaagattttgagaaaagattggtggaacgaattaaactattacggcttcctgatgattcaactgatgactatgagtttgatgctacggttctcgagtacggatcagataatccagagcctgaagtcgaattttttgacgaaatgttcatggtagatgatgcagatggtgaagtcttcccctggaatggtttcgttgagtttgaggatttcaattactttttatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box F-box-like LRR_6

Protein Analysis

128

Amino Acids

14.99

Weight (kDa)

4.1

Isoelectric Point (pI)

44.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025527)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0002209.1_g000026 Rmu_sc0010742.1_g000001
rosa_samantha Rh5DG116700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 91
AclWI GGATC 1 cut(s) 271
AcsI RAATTY 1 cut(s) 290
AcuI CTGAAG 1 cut(s) 303
AfaI GTAC 1 cut(s) 260
AfiI CCNNNNNNNGG 1 cut(s) 347
AgsI TTSAA 2 cut(s) 222, 373
AjnI CCWGG 1 cut(s) 341
AluBI AGCT 1 cut(s) 73
AluI AGCT 1 cut(s) 73
AlwI GGATC 1 cut(s) 271
AlwNI CAGNNNCTG 1 cut(s) 281
Ama87I CYCGRG 1 cut(s) 254
AoxI GGCC 1 cut(s) 5
ApoI RAATTY 1 cut(s) 290
ArsI GACNNNNNNTTYG 2 cut(s) 221, 253
Asp700I GAANNNNTTC 1 cut(s) 350
AspLEI GCGC 1 cut(s) 138
AsuHPI GGTGA 1 cut(s) 341
AvaI CYCGRG 1 cut(s) 254
BbsI GAAGAC 1 cut(s) 328
BccI CCATC 3 cut(s) 77, 98, 320
BceAI ACGGC 1 cut(s) 221
BciT130I CCWGG 1 cut(s) 343
BfmI CTRYAG 1 cut(s) 21
Bme1390I CCNGG 1 cut(s) 343
BmeT110I CYCGRG 1 cut(s) 254
BmrFI CCNGG 1 cut(s) 343
BmsI GCATC 2 cut(s) 232, 310
BpiI GAAGAC 1 cut(s) 328
BpmI CTGGAG 2 cut(s) 38, 179
BpuEI CTTGAG 1 cut(s) 140
BsaJI CCNNGG 1 cut(s) 341
BsaXI ACNNNNNCTCC 2 cut(s) 36, 66
Bsc4I CCNNNNNNNGG 1 cut(s) 347
Bse1I ACTGG 1 cut(s) 139
BseBI CCWGG 1 cut(s) 343
BseDI CCNNGG 1 cut(s) 341
BseLI CCNNNNNNNGG 1 cut(s) 347
BseNI ACTGG 1 cut(s) 139
BshFI GGCC 1 cut(s) 7
BsiHKCI CYCGRG 1 cut(s) 254
BslI CCNNNNNNNGG 1 cut(s) 347
BsnI GGCC 1 cut(s) 7
BsoBI CYCGRG 1 cut(s) 254
Bsp143I GATC 2 cut(s) 130, 263
BspACI CCGC 1 cut(s) 91
BspANI GGCC 1 cut(s) 7
BspPI GGATC 1 cut(s) 271
BsrI ACTGG 1 cut(s) 139
BssECI CCNNGG 1 cut(s) 341
BssMI GATC 2 cut(s) 130, 263
Bst2UI CCWGG 1 cut(s) 343
Bst4CI ACNGT 1 cut(s) 250
BstC8I GCNNGC 2 cut(s) 89, 93
BstHHI GCGC 1 cut(s) 138
BstKTI GATC 2 cut(s) 133, 266
BstMBI GATC 2 cut(s) 130, 263
BstNI CCWGG 1 cut(s) 343
BstSCI CCNGG 1 cut(s) 341
BstSFI CTRYAG 1 cut(s) 21
BstV2I GAAGAC 1 cut(s) 328
BsuRI GGCC 1 cut(s) 7
BtsIMutI CAGTG 1 cut(s) 146
Cac8I GCNNGC 2 cut(s) 89, 93
CaiI CAGNNNCTG 1 cut(s) 281
CfoI GCGC 1 cut(s) 138
Csp6I GTAC 1 cut(s) 259
CviAII CATG 1 cut(s) 310
CviJI RGCY 6 cut(s) 7, 73, 87, 95, 208, 280
CviKI_1 RGCY 6 cut(s) 7, 73, 87, 95, 208, 280
CviQI GTAC 1 cut(s) 259
DpnI GATC 2 cut(s) 132, 265
DpnII GATC 2 cut(s) 130, 263
Eco147I AGGCCT 1 cut(s) 7
Eco57I CTGAAG 1 cut(s) 303
Eco88I CYCGRG 1 cut(s) 254
EcoRII CCWGG 1 cut(s) 341
EcoT22I ATGCAT 1 cut(s) 39
FaeI CATG 1 cut(s) 313
FaiI YATR 7 cut(s) 23, 39, 65, 98, 234, 311, 385
FatI CATG 1 cut(s) 309
FauI CCCGC 1 cut(s) 84
GlaI GCGC 1 cut(s) 137
GsuI CTGGAG 2 cut(s) 38, 179
HaeIII GGCC 1 cut(s) 7
HhaI GCGC 1 cut(s) 138
Hin1II CATG 1 cut(s) 313
Hin6I GCGC 1 cut(s) 136
HinP1I GCGC 1 cut(s) 136
HinfI GANTC 2 cut(s) 122, 218
HphI GGTGA 1 cut(s) 341
Hpy188I TCNGA 1 cut(s) 268
Hpy188III TCNNGA 5 cut(s) 55, 158, 212, 254, 275
HpyCH4III ACNGT 1 cut(s) 250
HpyCH4V TGCA 3 cut(s) 14, 37, 323
Hsp92II CATG 1 cut(s) 313
HspAI GCGC 1 cut(s) 136
Kzo9I GATC 2 cut(s) 130, 263
LpnPI CCDG 9 cut(s) 12, 68, 143, 152, 225, 288, 294, 328, 355
LweI GCATC 2 cut(s) 232, 310
MaeIII GTNAC 2 cut(s) 123, 143
MalI GATC 2 cut(s) 132, 265
MboI GATC 2 cut(s) 130, 263
MboII GAAGA 2 cut(s) 176, 328
MluCI AATT 4 cut(s) 40, 192, 290, 373
MlyI GAGTC 1 cut(s) 131
MnlI CCTC 4 cut(s) 62, 123, 154, 358
Mph1103I ATGCAT 1 cut(s) 39
MroXI GAANNNNTTC 1 cut(s) 350
MseI TTAA 2 cut(s) 153, 195
MspR9I CCNGG 1 cut(s) 343
MvaI CCWGG 1 cut(s) 343
NdeII GATC 2 cut(s) 130, 263
NlaIII CATG 1 cut(s) 313
NmuCI GTSAC 1 cut(s) 123
NsiI ATGCAT 1 cut(s) 39
PaeR7I CTCGAG 1 cut(s) 254
PceI AGGCCT 1 cut(s) 7
PdmI GAANNNNTTC 1 cut(s) 350
PfeI GAWTC 1 cut(s) 218
PleI GAGTC 1 cut(s) 130
PpsI GAGTC 1 cut(s) 130
Psp6I CCWGG 1 cut(s) 341
PspGI CCWGG 1 cut(s) 341
PstNI CAGNNNCTG 1 cut(s) 281
RsaI GTAC 1 cut(s) 260
RsaNI GTAC 1 cut(s) 259
SaqAI TTAA 2 cut(s) 153, 195
Sau3AI GATC 2 cut(s) 130, 263
SchI GAGTC 1 cut(s) 131
ScrFI CCNGG 1 cut(s) 343
SetI ASST 2 cut(s) 54, 75
SfaNI GCATC 2 cut(s) 232, 310
SfcI CTRYAG 1 cut(s) 21
Sfr274I CTCGAG 1 cut(s) 254
SlaI CTCGAG 1 cut(s) 254
SmlI CTYRAG 2 cut(s) 119, 254
SmoI CTYRAG 2 cut(s) 119, 254
Sse9I AATT 4 cut(s) 40, 192, 290, 373
SseBI AGGCCT 1 cut(s) 7
SsiI CCGC 1 cut(s) 91
StuI AGGCCT 1 cut(s) 7
StyD4I CCNGG 1 cut(s) 341
TaaI ACNGT 1 cut(s) 250
TaqI TCGA 2 cut(s) 255, 288
TasI AATT 4 cut(s) 40, 192, 290, 373
TfiI GAWTC 1 cut(s) 218
Tru1I TTAA 2 cut(s) 153, 195
Tru9I TTAA 2 cut(s) 153, 195
TscAI CASTG 1 cut(s) 146
TseFI GTSAC 1 cut(s) 123
Tsp45I GTSAC 1 cut(s) 123
TspDTI ATGAA 2 cut(s) 80, 298
TspGWI ACGGA 1 cut(s) 276
TspRI CASTG 1 cut(s) 146
XapI RAATTY 1 cut(s) 290
XhoI CTCGAG 1 cut(s) 254
XmnI GAANNNNTTC 1 cut(s) 350
Zsp2I ATGCAT 1 cut(s) 39
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.