Rmu_sc0002380.1_g000014

Multiple C2 and transmembrane domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002380.1
Physical Location & Seq
Reverse (-)
107157 .. 108335
1179 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002380.1_g000014.1.cds

Sequence Viewer

Length: 1179 bp
atgcctaatactagtgtagacgctttctgtgtcgccaaatatgggccaaagtgggtgaggacaagaacagttgttgataattgttctccaaagtggaatgaacaatatatgtgggaagtctatgatcattgtacagtcataactattgcagttttccaaaataagtacttgctcaattgggaaagaaaccgtgatcgggaaattggaaaagtaaggattcggctatccaatcttgaatttgacaaagtttacacaaattcccatccccttgtgagtctagaaccttatggggtgatgaagagaggtgaacttcaattgtcttatcgattttgttctacatctaagttgaatgtgtaccatagttatacacaagccctttggcccaaactgcattatgttcttccactatcagtagctcagattcacagactaaggcctcaagctgttaagcttacagaatcaaggttgcagaaggctgagtcaccactaagcccagaggttgtgcagtatgtgttggatgataataagcataagtttagtctccgaagagctaaagctaattttttgaggtgtatgaaacttttagagtgtttctcactttacagacagcggtttgatcggctgcggaaatggactaatccattgcataatgctgtctttataatttccctcattgaggtcacttggttcccttggatggcactggcttctatgtttttcatgctttctggtataggggcttggggttactggaagaggcctaaacaacttcctcatatagacactgaattgtctcaggtttatagtgtccaccctgatgagattgctgaagagtttgattcatttccaacaagtgcaactgggaacattttgacgatcagatatcatcgactccaaggcattatattgaatgttcagacaacgcttggtgacattgcaactacaggggagagggtgcagtctttgttgagttggagggataaaaaagctacacttctcgctctgatcttctttttctctgctgggatggtgttttacatttacccttttagcgtgcgaagtcttgttttctggactatattgtatatgaccaggcatccaatgcttcgtattgaccttccttcatatttccacaacttcattaggaggatgccatcaaagatagacagcatgctatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

392

Amino Acids

46.25

Weight (kDa)

9.63

Isoelectric Point (pI)

46.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 662
AccI GTMKAC 1 cut(s) 18
AciI CCGC 2 cut(s) 610, 625
AcsI RAATTY 2 cut(s) 236, 256
AcuI CTGAAG 1 cut(s) 849
AfaI GTAC 3 cut(s) 133, 167, 356
AfiI CCNNNNNNNGG 4 cut(s) 42, 196, 676, 697
AgsI TTSAA 4 cut(s) 236, 314, 349, 910
AhlI ACTAGT 1 cut(s) 11
AjnI CCWGG 1 cut(s) 1091
AluBI AGCT 6 cut(s) 416, 443, 451, 551, 557, 989
AluI AGCT 6 cut(s) 416, 443, 451, 551, 557, 989
Alw26I GTCTC 2 cut(s) 545, 798
AoxI GGCC 4 cut(s) 44, 380, 434, 758
ApeKI GCWGC 1 cut(s) 622
ApoI RAATTY 2 cut(s) 236, 256
AspS9I GGNCC 2 cut(s) 44, 381
AsuHPI GGTGA 5 cut(s) 67, 304, 317, 474, 941
BbvI GCAGC 1 cut(s) 609
BccI CCATC 4 cut(s) 270, 691, 1021, 1162
BciT130I CCWGG 1 cut(s) 1093
BclI TGATCA 1 cut(s) 124
BcoDI GTCTC 2 cut(s) 545, 798
BcuI ACTAGT 1 cut(s) 11
BfaI CTAG 2 cut(s) 12, 278
BfmI CTRYAG 1 cut(s) 942
BisI GCNGC 1 cut(s) 623
BlsI GCNGC 1 cut(s) 624
BmcAI AGTACT 1 cut(s) 167
Bme1390I CCNGG 1 cut(s) 1093
BmgT120I GGNCC 2 cut(s) 44, 381
BmiI GGNNCC 1 cut(s) 689
BmrFI CCNGG 1 cut(s) 1093
BmrI ACTGGG 1 cut(s) 870
BmsI GCATC 2 cut(s) 1105, 1140
BmuI ACTGGG 1 cut(s) 870
BplI GAGNNNNNCTC 2 cut(s) 578, 610
BpuEI CTTGAG 1 cut(s) 423
Bsa29I ATCGAT 1 cut(s) 325
BsaJI CCNNGG 2 cut(s) 692, 895
Bsc4I CCNNNNNNNGG 4 cut(s) 42, 196, 676, 697
Bse1I ACTGG 3 cut(s) 708, 755, 865
Bse3DI GCAATG 2 cut(s) 641, 933
BseBI CCWGG 1 cut(s) 1093
BseCI ATCGAT 1 cut(s) 325
BseDI CCNNGG 2 cut(s) 692, 895
BseGI GGATG 6 cut(s) 262, 523, 702, 1032, 1096, 1155
BseLI CCNNNNNNNGG 4 cut(s) 42, 196, 676, 697
BseMI GCAATG 2 cut(s) 641, 933
BseMII CTCAG 3 cut(s) 431, 468, 809
BseNI ACTGG 3 cut(s) 708, 755, 865
BseXI GCAGC 1 cut(s) 609
BseYI CCCAGC 1 cut(s) 1022
BsgI GTGCAG 2 cut(s) 524, 977
BshFI GGCC 4 cut(s) 46, 382, 436, 760
BshVI ATCGAT 1 cut(s) 325
BslI CCNNNNNNNGG 4 cut(s) 42, 196, 676, 697
BsmAI GTCTC 2 cut(s) 545, 798
BsnI GGCC 4 cut(s) 46, 382, 436, 760
Bsp1407I TGTACA 1 cut(s) 131
Bsp143I GATC 5 cut(s) 124, 193, 616, 876, 1005
BspACI CCGC 2 cut(s) 610, 625
BspANI GGCC 4 cut(s) 46, 382, 436, 760
BspCNI CTCAG 3 cut(s) 430, 469, 808
BspDI ATCGAT 1 cut(s) 325
BspLI GGNNCC 1 cut(s) 689
BspQI GCTCTTC 1 cut(s) 541
BsrDI GCAATG 2 cut(s) 641, 933
BsrGI TGTACA 1 cut(s) 131
BsrI ACTGG 3 cut(s) 708, 755, 865
BssECI CCNNGG 2 cut(s) 692, 895
BssMI GATC 5 cut(s) 124, 193, 616, 876, 1005
BssT1I CCWWGG 2 cut(s) 692, 895
Bst2UI CCWGG 1 cut(s) 1093
Bst4CI ACNGT 3 cut(s) 70, 136, 191
Bst6I CTCTTC 4 cut(s) 293, 541, 749, 825
BstAPI GCANNNNNTGC 1 cut(s) 1102
BstAUI TGTACA 1 cut(s) 131
BstC8I GCNNGC 2 cut(s) 1055, 1172
BstDEI CTNAG 6 cut(s) 342, 417, 431, 477, 488, 795
BstENI CCTNNNNNAGG 1 cut(s) 674
BstF5I GGATG 6 cut(s) 262, 523, 702, 1032, 1096, 1155
BstKTI GATC 5 cut(s) 127, 196, 619, 879, 1008
BstMAI GTCTC 2 cut(s) 545, 798
BstMBI GATC 5 cut(s) 124, 193, 616, 876, 1005
BstMWI GCNNNNNNNGC 2 cut(s) 388, 1102
BstNI CCWGG 1 cut(s) 1093
BstNSI RCATGY 1 cut(s) 1174
BstSCI CCNGG 1 cut(s) 1091
BstSFI CTRYAG 1 cut(s) 942
BstV1I GCAGC 1 cut(s) 609
Bsu15I ATCGAT 1 cut(s) 325
BsuRI GGCC 4 cut(s) 46, 382, 436, 760
BsuTUI ATCGAT 1 cut(s) 325
BtsCI GGATG 6 cut(s) 262, 523, 702, 1032, 1096, 1155
BtsIMutI CAGTG 2 cut(s) 701, 783
Cac8I GCNNGC 2 cut(s) 1055, 1172
Cfr13I GGNCC 2 cut(s) 44, 381
ClaI ATCGAT 1 cut(s) 325
CseI GACGC 1 cut(s) 29
Csp6I GTAC 3 cut(s) 132, 166, 355
CspCI CAANNNNNGTGG 2 cut(s) 92, 127
CviAII CATG 2 cut(s) 721, 1171
CviQI GTAC 3 cut(s) 132, 166, 355
DdeI CTNAG 6 cut(s) 342, 417, 431, 477, 488, 795
DpnI GATC 5 cut(s) 126, 195, 618, 878, 1007
DpnII GATC 5 cut(s) 124, 193, 616, 876, 1005
Eam1104I CTCTTC 4 cut(s) 293, 541, 749, 825
EarI CTCTTC 4 cut(s) 293, 541, 749, 825
Eco130I CCWWGG 2 cut(s) 692, 895
Eco147I AGGCCT 2 cut(s) 436, 760
Eco32I GATATC 1 cut(s) 884
Eco57I CTGAAG 1 cut(s) 849
EcoNI CCTNNNNNAGG 1 cut(s) 674
EcoRII CCWGG 1 cut(s) 1091
EcoRV GATATC 1 cut(s) 884
EcoT14I CCWWGG 2 cut(s) 692, 895
ErhI CCWWGG 2 cut(s) 692, 895
FaeI CATG 2 cut(s) 724, 1174
FalI AAGNNNNNCTT 2 cut(s) 978, 1010
FatI CATG 2 cut(s) 720, 1170
FbaI TGATCA 1 cut(s) 124
FblI GTMKAC 1 cut(s) 18
Fnu4HI GCNGC 1 cut(s) 623
FokI GGATG 6 cut(s) 249, 530, 709, 1039, 1083, 1162
Fsp4HI GCNGC 1 cut(s) 623
FspBI CTAG 2 cut(s) 12, 278
GluI GCNGC 1 cut(s) 623
GsaI CCCAGC 1 cut(s) 1026
HaeIII GGCC 4 cut(s) 46, 382, 436, 760
HgaI GACGC 1 cut(s) 29
Hin1II CATG 2 cut(s) 724, 1174
HindIII AAGCTT 1 cut(s) 449
HinfI GANTC 7 cut(s) 217, 274, 421, 458, 479, 839, 891
HphI GGTGA 5 cut(s) 67, 304, 317, 474, 941
Hpy166II GTNNAC 5 cut(s) 19, 250, 308, 355, 811
Hpy188I TCNGA 5 cut(s) 420, 545, 881, 918, 1005
Hpy188III TCNNGA 4 cut(s) 197, 233, 278, 1072
Hpy8I GTNNAC 5 cut(s) 19, 250, 308, 355, 811
HpyAV CCTTC 3 cut(s) 466, 1127, 1131
HpyCH4III ACNGT 3 cut(s) 70, 136, 191
HpyCH4V TGCA 8 cut(s) 149, 391, 469, 505, 646, 857, 938, 958
HpyF10VI GCNNNNNNNGC 2 cut(s) 388, 1102
HpyF3I CTNAG 6 cut(s) 342, 417, 431, 477, 488, 795
Hsp92II CATG 2 cut(s) 724, 1174
Ksp22I TGATCA 1 cut(s) 124
Kzo9I GATC 5 cut(s) 124, 193, 616, 876, 1005
LguI GCTCTTC 1 cut(s) 541
Lsp1109I GCAGC 1 cut(s) 609
LweI GCATC 2 cut(s) 1105, 1140
MaeI CTAG 2 cut(s) 12, 278
MaeIII GTNAC 4 cut(s) 480, 679, 746, 929
MalI GATC 5 cut(s) 126, 195, 618, 878, 1007
MboI GATC 5 cut(s) 124, 193, 616, 876, 1005
MboII GAAGA 6 cut(s) 310, 392, 558, 766, 842, 1000
MfeI CAATTG 2 cut(s) 175, 314
MluCI AATT 9 cut(s) 79, 175, 201, 236, 256, 314, 559, 663, 788
MlyI GAGTC 3 cut(s) 283, 488, 885
MmeI TCCRAC 3 cut(s) 495, 872, 953
MseI TTAA 1 cut(s) 447
MslI CAYNNNNRTG 1 cut(s) 816
MspA1I CMGCKG 1 cut(s) 610
MspR9I CCNGG 1 cut(s) 1093
MunI CAATTG 2 cut(s) 175, 314
MvaI CCWGG 1 cut(s) 1093
MwoI GCNNNNNNNGC 2 cut(s) 388, 1102
NdeII GATC 5 cut(s) 124, 193, 616, 876, 1005
NlaIII CATG 2 cut(s) 724, 1174
NlaIV GGNNCC 1 cut(s) 689
NmuCI GTSAC 3 cut(s) 480, 679, 929
NspI RCATGY 1 cut(s) 1174
PaeI GCATGC 1 cut(s) 1174
PceI AGGCCT 2 cut(s) 436, 760
PciSI GCTCTTC 1 cut(s) 541
PfeI GAWTC 4 cut(s) 217, 421, 458, 839
PkrI GCNGC 1 cut(s) 624
PleI GAGTC 3 cut(s) 282, 487, 885
PpsI GAGTC 3 cut(s) 282, 487, 885
PsiI TTATAA 1 cut(s) 662
Psp6I CCWGG 1 cut(s) 1091
PspFI CCCAGC 1 cut(s) 1022
PspGI CCWGG 1 cut(s) 1091
PspN4I GGNNCC 1 cut(s) 689
PspPI GGNCC 2 cut(s) 44, 381
RsaI GTAC 3 cut(s) 133, 167, 356
RsaNI GTAC 3 cut(s) 132, 166, 355
RseI CAYNNNNRTG 1 cut(s) 816
SapI GCTCTTC 1 cut(s) 541
SaqAI TTAA 1 cut(s) 447
SatI GCNGC 1 cut(s) 623
Sau3AI GATC 5 cut(s) 124, 193, 616, 876, 1005
Sau96I GGNCC 2 cut(s) 44, 381
ScaI AGTACT 1 cut(s) 167
SchI GAGTC 3 cut(s) 283, 488, 885
ScrFI CCNGG 1 cut(s) 1093
SfaNI GCATC 2 cut(s) 1105, 1140
SfcI CTRYAG 1 cut(s) 942
SmiMI CAYNNNNRTG 1 cut(s) 816
SmlI CTYRAG 1 cut(s) 438
SmoI CTYRAG 1 cut(s) 438
SpeI ACTAGT 1 cut(s) 11
SphI GCATGC 1 cut(s) 1174
Sse9I AATT 9 cut(s) 79, 175, 201, 236, 256, 314, 559, 663, 788
SseBI AGGCCT 2 cut(s) 436, 760
SsiI CCGC 2 cut(s) 610, 625
SspMI CTAG 2 cut(s) 12, 278
StuI AGGCCT 2 cut(s) 436, 760
StyD4I CCNGG 1 cut(s) 1091
StyI CCWWGG 2 cut(s) 692, 895
TaaI ACNGT 3 cut(s) 70, 136, 191
TaqI TCGA 2 cut(s) 325, 889
TasI AATT 9 cut(s) 79, 175, 201, 236, 256, 314, 559, 663, 788
TatI WGTACW 2 cut(s) 131, 165
TfiI GAWTC 4 cut(s) 217, 421, 458, 839
Tru1I TTAA 1 cut(s) 447
Tru9I TTAA 1 cut(s) 447
TscAI CASTG 2 cut(s) 708, 790
TseFI GTSAC 3 cut(s) 480, 679, 929
TseI GCWGC 1 cut(s) 622
Tsp45I GTSAC 3 cut(s) 480, 679, 929
TspDTI ATGAA 7 cut(s) 114, 311, 590, 709, 831, 1113, 1129
TspRI CASTG 2 cut(s) 708, 790
XagI CCTNNNNNAGG 1 cut(s) 674
XapI RAATTY 2 cut(s) 236, 256
XbaI TCTAGA 1 cut(s) 277
XceI RCATGY 1 cut(s) 1174
XmiI GTMKAC 1 cut(s) 18
XspI CTAG 2 cut(s) 12, 278
ZrmI AGTACT 1 cut(s) 167
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.