Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002456.1

Orthogroup ID

OG0021324

Physical Location & Seq

Genomic Coordinates Reverse (-)

14982 .. 15674

Gene Structure 693 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002456.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 375 bp

atggcccctgacaaggagtacgagaactggcgatggaagccttctcagtgtgacctcccaccgtttgatgccataaaatttcatgaactgatgagagggaagacaatagctttcatcggcgattcaatcaatcgaggccacatggaatccttactctgtagaagttccataaatgggaagcaaccgtggactgcaaacctacacttccaagtcctcattcgtgacaattgttcgaatttggtcctcacggctcatcaacgaagcacatggagatttcgccccgatggtgtgttgaagctccatctcggtgtcccggacaaacatttcatcggtataatcccacaatttgatgtgatggttctttcttctggctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005794 GO:0007275 GO:0007568 GO:0008150 GO:0008374 GO:0009987 GO:0010150 GO:0012505 GO:0016407 GO:0016413 GO:0016740 GO:0016746 GO:0016747 GO:0032501 GO:0032502 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464 GO:0048366 GO:0048367 GO:0048731 GO:0048827 GO:0048856 GO:0071554 GO:0090693 GO:0099402

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PC-Esterase PMR5N

Protein Analysis

124

Amino Acids

14.27

Weight (kDa)

8.93

Isoelectric Point (pI)

29.97

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021324)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0375171
rosa_multiflora	Rmu_sc0002456.1_g000003
rosa_samantha	Rh1BG365000 Rh1CG377900 Rh1DG395700

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	2 cut(s)	77, 235
AfaI	GTAC	1 cut(s)	20
AfiI	CCNNNNNNNGG	2 cut(s)	13, 174
AgsI	TTSAA	2 cut(s)	126, 295
AjuI	GAANNNNNNNTTGG	2 cut(s)	201, 233
AluBI	AGCT	2 cut(s)	110, 298
AluI	AGCT	2 cut(s)	110, 298
AoxI	GGCC	2 cut(s)	3, 136
ApoI	RAATTY	2 cut(s)	77, 235
AspS9I	GGNCC	2 cut(s)	4, 241
AsuC2I	CCSGG	1 cut(s)	314
AsuII	TTCGAA	1 cut(s)	233
AvaII	GGWCC	1 cut(s)	241
BbsI	GAAGAC	1 cut(s)	107
BccI	CCATC	4 cut(s)	27, 278, 309, 349
BceAI	ACGGC	1 cut(s)	264
BcnI	CCSGG	1 cut(s)	314
BfaI	CTAG	1 cut(s)	373
BfmI	CTRYAG	1 cut(s)	157
Bme1390I	CCNGG	1 cut(s)	314
Bme18I	GGWCC	1 cut(s)	241
BmgT120I	GGNCC	2 cut(s)	4, 241
BmiI	GGNNCC	1 cut(s)	6
BmrFI	CCNGG	1 cut(s)	314
BmsI	GCATC	1 cut(s)	58
BpiI	GAAGAC	1 cut(s)	107
Bpu14I	TTCGAA	1 cut(s)	233
BpuMI	CCSGG	1 cut(s)	314
BsaJI	CCNNGG	1 cut(s)	185
Bsc4I	CCNNNNNNNGG	2 cut(s)	13, 174
Bse1I	ACTGG	1 cut(s)	32
BseDI	CCNNGG	1 cut(s)	185
BseLI	CCNNNNNNNGG	2 cut(s)	13, 174
BseMII	CTCAG	1 cut(s)	59
BseNI	ACTGG	1 cut(s)	32
BshFI	GGCC	2 cut(s)	5, 138
BsiSI	CCGG	1 cut(s)	314
BslFI	GGGAC	1 cut(s)	296
BslI	CCNNNNNNNGG	2 cut(s)	13, 174
BsmFI	GGGAC	1 cut(s)	296
BsnI	GGCC	2 cut(s)	5, 138
Bsp119I	TTCGAA	1 cut(s)	233
BspANI	GGCC	2 cut(s)	5, 138
BspCNI	CTCAG	1 cut(s)	58
BspHI	TCATGA	1 cut(s)	82
BspLI	GGNNCC	1 cut(s)	6
BspT104I	TTCGAA	1 cut(s)	233
BsrI	ACTGG	1 cut(s)	32
BssECI	CCNNGG	1 cut(s)	185
Bst4CI	ACNGT	2 cut(s)	63, 186
BstBI	TTCGAA	1 cut(s)	233
BstDEI	CTNAG	1 cut(s)	45
BstDSI	CCRYGG	1 cut(s)	185
BstMWI	GCNNNNNNNGC	1 cut(s)	37
BstSCI	CCNGG	1 cut(s)	312
BstSFI	CTRYAG	1 cut(s)	157
BstV2I	GAAGAC	1 cut(s)	107
BsuRI	GGCC	2 cut(s)	5, 138
BtgI	CCRYGG	1 cut(s)	185
BtgZI	GCGATG	1 cut(s)	46
BtsIMutI	CAGTG	1 cut(s)	53
CciI	TCATGA	1 cut(s)	82
Cfr13I	GGNCC	2 cut(s)	4, 241
Csp6I	GTAC	1 cut(s)	19
CviAII	CATG	3 cut(s)	83, 142, 267
CviJI	RGCY	7 cut(s)	5, 40, 110, 138, 251, 298, 372
CviKI_1	RGCY	7 cut(s)	5, 40, 110, 138, 251, 298, 372
CviQI	GTAC	1 cut(s)	19
DdeI	CTNAG	1 cut(s)	45
Eco47I	GGWCC	1 cut(s)	241
FaeI	CATG	3 cut(s)	86, 145, 270
FaiI	YATR	6 cut(s)	74, 84, 143, 170, 268, 335
FaqI	GGGAC	1 cut(s)	296
FatI	CATG	3 cut(s)	82, 141, 266
FspBI	CTAG	1 cut(s)	373
HaeIII	GGCC	2 cut(s)	5, 138
HapII	CCGG	1 cut(s)	314
Hin1II	CATG	3 cut(s)	86, 145, 270
HinfI	GANTC	2 cut(s)	122, 146
HpaII	CCGG	1 cut(s)	314
Hpy166II	GTNNAC	1 cut(s)	189
Hpy188III	TCNNGA	2 cut(s)	83, 221
Hpy8I	GTNNAC	1 cut(s)	189
HpyAV	CCTTC	1 cut(s)	51
HpyCH4III	ACNGT	2 cut(s)	63, 186
HpyCH4V	TGCA	1 cut(s)	194
HpyF10VI	GCNNNNNNNGC	1 cut(s)	37
HpyF3I	CTNAG	1 cut(s)	45
Hsp92II	CATG	3 cut(s)	86, 145, 270
LmnI	GCTCC	1 cut(s)	303
LpnPI	CCDG	4 cut(s)	13, 21, 327, 354
LweI	GCATC	1 cut(s)	58
MaeI	CTAG	1 cut(s)	373
MaeIII	GTNAC	2 cut(s)	50, 221
MboII	GAAGA	2 cut(s)	112, 357
MfeI	CAATTG	1 cut(s)	226
MluCI	AATT	4 cut(s)	77, 226, 235, 344
MnlI	CCTC	5 cut(s)	65, 89, 128, 224, 254
MslI	CAYNNNNRTG	1 cut(s)	306
MspI	CCGG	1 cut(s)	314
MspR9I	CCNGG	1 cut(s)	314
MunI	CAATTG	1 cut(s)	226
MwoI	GCNNNNNNNGC	1 cut(s)	37
NciI	CCSGG	1 cut(s)	314
NlaIII	CATG	3 cut(s)	86, 145, 270
NlaIV	GGNNCC	1 cut(s)	6
NmuCI	GTSAC	2 cut(s)	50, 221
NspV	TTCGAA	1 cut(s)	233
PagI	TCATGA	1 cut(s)	82
PfeI	GAWTC	2 cut(s)	122, 146
PfoI	TCCNGGA	1 cut(s)	312
PspN4I	GGNNCC	1 cut(s)	6
PspPI	GGNCC	2 cut(s)	4, 241
RsaI	GTAC	1 cut(s)	20
RsaNI	GTAC	1 cut(s)	19
RseI	CAYNNNNRTG	1 cut(s)	306
Sau96I	GGNCC	2 cut(s)	4, 241
ScrFI	CCNGG	1 cut(s)	314
SetI	ASST	4 cut(s)	57, 112, 201, 300
SfaNI	GCATC	1 cut(s)	58
SfcI	CTRYAG	1 cut(s)	157
SfuI	TTCGAA	1 cut(s)	233
SinI	GGWCC	1 cut(s)	241
SmiMI	CAYNNNNRTG	1 cut(s)	306
Sse9I	AATT	4 cut(s)	77, 226, 235, 344
SspMI	CTAG	1 cut(s)	373
StyD4I	CCNGG	1 cut(s)	312
TaaI	ACNGT	2 cut(s)	63, 186
TaqI	TCGA	2 cut(s)	133, 233
TasI	AATT	4 cut(s)	77, 226, 235, 344
TfiI	GAWTC	2 cut(s)	122, 146
TscAI	CASTG	1 cut(s)	53
TseFI	GTSAC	2 cut(s)	50, 221
Tsp45I	GTSAC	2 cut(s)	50, 221
TspDTI	ATGAA	4 cut(s)	71, 99, 103, 316
TspRI	CASTG	1 cut(s)	53
VpaK11BI	GGWCC	1 cut(s)	241
XapI	RAATTY	2 cut(s)	77, 235
XspI	CTAG	1 cut(s)	373

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.