Rmu_sc0002466.1_g000002

Chloroplastic group IIA intron splicing facilitator CRS1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002466.1
OG0021653
Physical Location & Seq
Reverse (-)
8769 .. 9230
462 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 462 bp
atggtgatttcaaaaggcttaattggggctgctgtggatgaaattttatctggggatagtgaaaatgatgaaaatgcggaaccttttgtgtcttctggtcgtgattatcaagcttctactcggttgccttgggagagagaaggtgaattgggtaatggggatggtggtaagacaataaagaagtggagtaatacgctttcggctgaggcatcccttccggagcatgagttgaagaggctaaggaatgtttatttgaggatgttggaaaggactaaagtcggaactaccggtatcacacagggtttggtggatgctatacatgagaagtggatggtggatgaagtggtcaagttgaagtttgaggagccactctcacttaacatgaaaagaactcatggaattttagaggttggtgtcagtacattgttatatatcttactctctttcatctatatcaattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CRS1_YhbY

Protein Analysis

153

Amino Acids

17.08

Weight (kDa)

5.27

Isoelectric Point (pI)

23.22

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CRS1_YhbY PF01985 72 - 137 4.2e-10 CRS1 / YhbY (CRM) domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021653)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0002466.1_g000002
rosa_samantha Rh1DG193500 Rh4AG154000 Rh4CG162600 Rh5AG090200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 217
AciI CCGC 1 cut(s) 77
AcsI RAATTY 2 cut(s) 42, 399
AfaI GTAC 1 cut(s) 421
AgeI ACCGGT 1 cut(s) 287
AgsI TTSAA 3 cut(s) 12, 232, 355
AluBI AGCT 1 cut(s) 113
AluI AGCT 1 cut(s) 113
Aor13HI TCCGGA 1 cut(s) 217
ApeKI GCWGC 1 cut(s) 29
ApoI RAATTY 2 cut(s) 42, 399
AsiGI ACCGGT 1 cut(s) 287
AsuHPI GGTGA 2 cut(s) 16, 155
BbsI GAAGAC 1 cut(s) 84
BbvCI CCTCAGC 1 cut(s) 204
BbvI GCAGC 1 cut(s) 16
BccI CCATC 2 cut(s) 155, 325
BisI GCNGC 1 cut(s) 30
BlsI GCNGC 1 cut(s) 31
BmiI GGNNCC 2 cut(s) 81, 366
BmsI GCATC 2 cut(s) 218, 301
BoxI GACNNNNGTC 1 cut(s) 275
BpiI GAAGAC 1 cut(s) 84
BplI GAGNNNNNCTC 2 cut(s) 356, 388
Bpu10I CCTNAGC 2 cut(s) 204, 239
BsaJI CCNNGG 1 cut(s) 128
BsaWI WCCGGW 2 cut(s) 217, 287
BsaXI ACNNNNNCTCC 2 cut(s) 212, 242
Bse118I RCCGGY 1 cut(s) 287
BseAI TCCGGA 1 cut(s) 217
BseDI CCNNGG 1 cut(s) 128
BseGI GGATG 7 cut(s) 43, 166, 209, 264, 316, 336, 343
BseMII CTCAG 1 cut(s) 195
BseRI GAGGAG 1 cut(s) 377
BseXI GCAGC 1 cut(s) 16
BshTI ACCGGT 1 cut(s) 287
BsiSI CCGG 2 cut(s) 218, 288
Bsp13I TCCGGA 1 cut(s) 217
BspACI CCGC 1 cut(s) 77
BspCNI CTCAG 1 cut(s) 196
BspEI TCCGGA 1 cut(s) 217
BspLI GGNNCC 2 cut(s) 81, 366
BsrFI RCCGGY 1 cut(s) 287
BssAI RCCGGY 1 cut(s) 287
BssECI CCNNGG 1 cut(s) 128
BssT1I CCWWGG 1 cut(s) 128
Bst6I CTCTTC 1 cut(s) 227
BstDEI CTNAG 2 cut(s) 204, 239
BstF5I GGATG 7 cut(s) 43, 166, 209, 264, 316, 336, 343
BstPAI GACNNNNGTC 1 cut(s) 275
BstV1I GCAGC 1 cut(s) 16
BstV2I GAAGAC 1 cut(s) 84
BtsCI GGATG 7 cut(s) 43, 166, 209, 264, 316, 336, 343
Cfr10I RCCGGY 1 cut(s) 287
Csp6I GTAC 1 cut(s) 420
CspAI ACCGGT 1 cut(s) 287
CviAII CATG 4 cut(s) 224, 320, 382, 395
CviJI RGCY 6 cut(s) 18, 29, 113, 203, 238, 367
CviKI_1 RGCY 6 cut(s) 18, 29, 113, 203, 238, 367
CviQI GTAC 1 cut(s) 420
DdeI CTNAG 2 cut(s) 204, 239
Eam1104I CTCTTC 1 cut(s) 227
EarI CTCTTC 1 cut(s) 227
Eco130I CCWWGG 1 cut(s) 128
EcoT14I CCWWGG 1 cut(s) 128
ErhI CCWWGG 1 cut(s) 128
FaeI CATG 4 cut(s) 227, 323, 385, 398
FaiI YATR 8 cut(s) 225, 317, 321, 383, 396, 430, 432, 453
FatI CATG 4 cut(s) 223, 319, 381, 394
Fnu4HI GCNGC 1 cut(s) 30
FokI GGATG 7 cut(s) 50, 173, 196, 271, 323, 343, 350
Fsp4HI GCNGC 1 cut(s) 30
GluI GCNGC 1 cut(s) 30
HapII CCGG 2 cut(s) 218, 288
Hin1II CATG 4 cut(s) 227, 323, 385, 398
HindIII AAGCTT 1 cut(s) 111
HpaII CCGG 2 cut(s) 218, 288
HphI GGTGA 2 cut(s) 16, 155
Hpy188I TCNGA 1 cut(s) 281
Hpy188III TCNNGA 2 cut(s) 101, 218
HpyAV CCTTC 2 cut(s) 134, 224
HpyF3I CTNAG 2 cut(s) 204, 239
Hsp92II CATG 4 cut(s) 227, 323, 385, 398
Kpn2I TCCGGA 1 cut(s) 217
LmnI GCTCC 2 cut(s) 220, 364
LpnPI CCDG 5 cut(s) 36, 81, 231, 284, 301
Lsp1109I GCAGC 1 cut(s) 16
LweI GCATC 2 cut(s) 218, 301
MboII GAAGA 2 cut(s) 84, 244
MfeI CAATTG 1 cut(s) 457
MluCI AATT 5 cut(s) 21, 42, 146, 399, 457
MmeI TCCRAC 2 cut(s) 243, 259
MnlI CCTC 5 cut(s) 199, 228, 249, 355, 400
MroI TCCGGA 1 cut(s) 217
MseI TTAA 2 cut(s) 20, 378
MspI CCGG 2 cut(s) 218, 288
MunI CAATTG 1 cut(s) 457
NlaIII CATG 4 cut(s) 227, 323, 385, 398
NlaIV GGNNCC 2 cut(s) 81, 366
PinAI ACCGGT 1 cut(s) 287
PkrI GCNGC 1 cut(s) 31
PshAI GACNNNNGTC 1 cut(s) 275
PspN4I GGNNCC 2 cut(s) 81, 366
RsaI GTAC 1 cut(s) 421
RsaNI GTAC 1 cut(s) 420
SaqAI TTAA 2 cut(s) 20, 378
SatI GCNGC 1 cut(s) 30
SetI ASST 4 cut(s) 85, 115, 145, 411
SfaNI GCATC 2 cut(s) 218, 301
Sse9I AATT 5 cut(s) 21, 42, 146, 399, 457
SsiI CCGC 1 cut(s) 77
StyI CCWWGG 1 cut(s) 128
TasI AATT 5 cut(s) 21, 42, 146, 399, 457
TatI WGTACW 1 cut(s) 419
Tru1I TTAA 2 cut(s) 20, 378
Tru9I TTAA 2 cut(s) 20, 378
TseI GCWGC 1 cut(s) 29
TspDTI ATGAA 5 cut(s) 54, 84, 354, 398, 436
XapI RAATTY 2 cut(s) 42, 399
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.