Rmu_sc0002541.1_g000028

12-oxophytodienoate reductase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002541.1
OG0022855
Physical Location & Seq
Reverse (-)
101673 .. 103100
1428 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 495 bp
atggattcaagtacccttgcaattggaccaagaaaagaggatgaattacagatcagggggttcaccaccgtttttcaaccaaatggacaagctccaatatcttctactgaaaagccactaacgcctcaagtactatctaacggtattgatgttgctgaattcacgcctccaaggcaattaaggacatatgaaatcccacaaattgtcaatgactttagacttgctgcaaggaatgcaatcgaagctgagaatcgctgccaatttgctctggaaaccattgaagctgttaatgaaataggagcagataaagttggaattagattatctccattcgcggactatatggaagcaggggattcaaaccctgaagcattaggcctttatatggctcaatccttgaacaatgggattctgtactgccatgtgattgagccaagaatgaaggaagctgaagctggagtaaaaagtgaaaatgctgaagtcttctacccatga

Protein Analysis

164

Amino Acids

18.09

Weight (kDa)

4.57

Isoelectric Point (pI)

47.18

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Oxidored_FMN PF00724 82 - 151 5.3e-08 NADH:flavin oxidoreductase / NADH oxidase family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022855)

Species Orthologous Gene IDs
rosa_laevigata RLG00000001496
rosa_multiflora Rmu_sc0002541.1_g000028 Rmu_sc0007103.1_g000015
rosa_roxburghii Rroxscaffold_3G00230170

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 335
AciI CCGC 1 cut(s) 335
AcsI RAATTY 1 cut(s) 158
AcuI CTGAAG 2 cut(s) 387, 471
AfaI GTAC 3 cut(s) 13, 132, 416
AfiI CCNNNNNNNGG 1 cut(s) 385
AgsI TTSAA 5 cut(s) 9, 77, 281, 360, 400
AluBI AGCT 5 cut(s) 92, 245, 284, 449, 455
AluI AGCT 5 cut(s) 92, 245, 284, 449, 455
AoxI GGCC 1 cut(s) 376
ApeKI GCWGC 2 cut(s) 224, 255
ApoI RAATTY 1 cut(s) 158
AspS9I GGNCC 1 cut(s) 26
AsuHPI GGTGA 1 cut(s) 55
AvaII GGWCC 1 cut(s) 26
BbsI GAAGAC 1 cut(s) 475
BbvI GCAGC 2 cut(s) 211, 242
BglI GCCNNNNNGGC 1 cut(s) 172
BisI GCNGC 2 cut(s) 225, 256
BlsI GCNGC 2 cut(s) 226, 257
BmcAI AGTACT 1 cut(s) 132
Bme18I GGWCC 1 cut(s) 26
BmgT120I GGNCC 1 cut(s) 26
BpiI GAAGAC 1 cut(s) 475
BpmI CTGGAG 1 cut(s) 477
BpuEI CTTGAG 1 cut(s) 111
BsaJI CCNNGG 1 cut(s) 170
Bsc4I CCNNNNNNNGG 1 cut(s) 385
BseDI CCNNGG 1 cut(s) 170
BseGI GGATG 1 cut(s) 46
BseLI CCNNNNNNNGG 1 cut(s) 385
BseMII CTCAG 1 cut(s) 237
BseXI GCAGC 2 cut(s) 211, 242
Bsh1236I CGCG 1 cut(s) 335
BshFI GGCC 1 cut(s) 378
BslI CCNNNNNNNGG 1 cut(s) 385
BsmI GAATGC 1 cut(s) 238
BsnI GGCC 1 cut(s) 378
Bsp143I GATC 1 cut(s) 51
BspACI CCGC 1 cut(s) 335
BspANI GGCC 1 cut(s) 378
BspCNI CTCAG 1 cut(s) 238
BspFNI CGCG 1 cut(s) 335
BssECI CCNNGG 1 cut(s) 170
BssMI GATC 1 cut(s) 51
BssT1I CCWWGG 1 cut(s) 170
Bst4CI ACNGT 2 cut(s) 70, 143
BstAPI GCANNNNNTGC 1 cut(s) 233
BstDEI CTNAG 1 cut(s) 246
BstF5I GGATG 1 cut(s) 46
BstFNI CGCG 1 cut(s) 335
BstKTI GATC 1 cut(s) 54
BstMBI GATC 1 cut(s) 51
BstMWI GCNNNNNNNGC 4 cut(s) 121, 172, 233, 242
BstUI CGCG 1 cut(s) 335
BstV1I GCAGC 2 cut(s) 211, 242
BstV2I GAAGAC 1 cut(s) 475
BsuRI GGCC 1 cut(s) 378
BtsCI GGATG 1 cut(s) 46
Cfr13I GGNCC 1 cut(s) 26
Csp6I GTAC 3 cut(s) 12, 131, 415
CviAII CATG 2 cut(s) 422, 492
CviJI RGCY 9 cut(s) 92, 115, 245, 284, 378, 389, 433, 449, 455
CviKI_1 RGCY 9 cut(s) 92, 115, 245, 284, 378, 389, 433, 449, 455
CviQI GTAC 3 cut(s) 12, 131, 415
DdeI CTNAG 1 cut(s) 246
DpnI GATC 1 cut(s) 53
DpnII GATC 1 cut(s) 51
Eco130I CCWWGG 1 cut(s) 170
Eco147I AGGCCT 1 cut(s) 378
Eco47I GGWCC 1 cut(s) 26
Eco57I CTGAAG 2 cut(s) 387, 471
EcoRI GAATTC 1 cut(s) 158
EcoT14I CCWWGG 1 cut(s) 170
ErhI CCWWGG 1 cut(s) 170
FaeI CATG 2 cut(s) 425, 495
FaiI YATR 8 cut(s) 187, 189, 342, 344, 384, 386, 423, 493
FatI CATG 2 cut(s) 421, 491
FauNDI CATATG 1 cut(s) 187
Fnu4HI GCNGC 2 cut(s) 225, 256
FokI GGATG 1 cut(s) 53
Fsp4HI GCNGC 2 cut(s) 225, 256
GluI GCNGC 2 cut(s) 225, 256
GsuI CTGGAG 1 cut(s) 477
HaeIII GGCC 1 cut(s) 378
Hin1II CATG 2 cut(s) 425, 495
HinfI GANTC 4 cut(s) 5, 250, 356, 409
HphI GGTGA 1 cut(s) 55
Hpy166II GTNNAC 1 cut(s) 63
Hpy188III TCNNGA 1 cut(s) 269
Hpy8I GTNNAC 1 cut(s) 63
HpyAV CCTTC 1 cut(s) 436
HpyCH4III ACNGT 2 cut(s) 70, 143
HpyCH4V TGCA 3 cut(s) 20, 227, 236
HpyF10VI GCNNNNNNNGC 4 cut(s) 121, 172, 233, 242
HpyF3I CTNAG 1 cut(s) 246
Hsp92II CATG 2 cut(s) 425, 495
Kzo9I GATC 1 cut(s) 51
LmnI GCTCC 2 cut(s) 97, 299
LpnPI CCDG 5 cut(s) 40, 254, 336, 378, 441
Lsp1109I GCAGC 2 cut(s) 211, 242
MalI GATC 1 cut(s) 53
MboI GATC 1 cut(s) 51
MboII GAAGA 2 cut(s) 93, 475
MfeI CAATTG 1 cut(s) 21
MluCI AATT 7 cut(s) 21, 44, 158, 176, 201, 260, 315
MmeI TCCRAC 1 cut(s) 292
MnlI CCTC 3 cut(s) 31, 135, 177
MseI TTAA 2 cut(s) 179, 288
MunI CAATTG 1 cut(s) 21
Mva1269I GAATGC 1 cut(s) 238
MvnI CGCG 1 cut(s) 335
MwoI GCNNNNNNNGC 4 cut(s) 121, 172, 233, 242
NdeI CATATG 1 cut(s) 187
NdeII GATC 1 cut(s) 51
NlaIII CATG 2 cut(s) 425, 495
PceI AGGCCT 1 cut(s) 378
PctI GAATGC 1 cut(s) 238
PfeI GAWTC 4 cut(s) 5, 250, 356, 409
PkrI GCNGC 2 cut(s) 226, 257
PspPI GGNCC 1 cut(s) 26
RsaI GTAC 3 cut(s) 13, 132, 416
RsaNI GTAC 3 cut(s) 12, 131, 415
SaqAI TTAA 2 cut(s) 179, 288
SatI GCNGC 2 cut(s) 225, 256
Sau3AI GATC 1 cut(s) 51
Sau96I GGNCC 1 cut(s) 26
ScaI AGTACT 1 cut(s) 132
SetI ASST 5 cut(s) 94, 247, 286, 451, 457
SinI GGWCC 1 cut(s) 26
SmlI CTYRAG 1 cut(s) 126
SmoI CTYRAG 1 cut(s) 126
Sse9I AATT 7 cut(s) 21, 44, 158, 176, 201, 260, 315
SseBI AGGCCT 1 cut(s) 378
SsiI CCGC 1 cut(s) 335
StuI AGGCCT 1 cut(s) 378
StyI CCWWGG 1 cut(s) 170
TaaI ACNGT 2 cut(s) 70, 143
TaqI TCGA 1 cut(s) 240
TasI AATT 7 cut(s) 21, 44, 158, 176, 201, 260, 315
TatI WGTACW 2 cut(s) 130, 414
TfiI GAWTC 4 cut(s) 5, 250, 356, 409
Tru1I TTAA 2 cut(s) 179, 288
Tru9I TTAA 2 cut(s) 179, 288
TseI GCWGC 2 cut(s) 224, 255
TspDTI ATGAA 4 cut(s) 57, 204, 306, 455
VpaK11BI GGWCC 1 cut(s) 26
XapI RAATTY 1 cut(s) 158
ZrmI AGTACT 1 cut(s) 132
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.