Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0007103.1

Orthogroup ID

OG0022855

Physical Location & Seq

Genomic Coordinates Reverse (-)

70066 .. 71438

Gene Structure 1373 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0007103.1_g000015.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 537 bp

atggattcaagtactcttgcaattggaccaagaaaagaggatgaattacagatcaggggtttcaccaccgtttttcaaccaaatggacaagctccaatatcttctactgacaagccactaacgcctcaagtactatctaacggtattgatggtcctgaattcacatctccaaggcaattaaggacatatgaaatcccacaaattgtcaatgactttagacttgctgcaaggaatgcaatcgaagctggctttcatggggttgaaattcatggagctactggtcaccttgttgatccgtttctgaaagaccaagtgaatgatcgaacagaccaatctggtggatctctagagaatcgctaccagtttgctctggaaatcattgaagctgttaatgaaaaaggagcagataaagttggaattagattatcttcatttgcggactatatggaatcaggggattcaaaccctgaagcattgggcctttatatggttcaatccttgaacaaatatgggattctgtactgccatgtgatttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0006950 GO:0008150 GO:0008152 GO:0009611 GO:0016491 GO:0016627 GO:0016628 GO:0016629 GO:0044464 GO:0050896 GO:0055114

KEGG Pathways

Metabolic & Signaling

ko00592 ko01100 ko01110 map00592 map01100 map01110

Pfam Domains

Protein Families

Oxidored_FMN

Protein Analysis

178

Amino Acids

19.57

Weight (kDa)

4.83

Isoelectric Point (pI)

39.36

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022855)

Species	Orthologous Gene IDs
rosa_laevigata	RLG00000001496
rosa_multiflora	Rmu_sc0002541.1_g000028 Rmu_sc0007103.1_g000015
rosa_roxburghii	Rroxscaffold_3G00230170

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	437
AclWI	GGATC	2 cut(s)	287, 349
AcsI	RAATTY	2 cut(s)	158, 264
AcuI	CTGAAG	1 cut(s)	489
AfaI	GTAC	3 cut(s)	13, 132, 521
AfiI	CCNNNNNNNGG	1 cut(s)	487
AgsI	TTSAA	7 cut(s)	9, 77, 263, 383, 462, 494, 502
AluBI	AGCT	4 cut(s)	92, 245, 275, 386
AluI	AGCT	4 cut(s)	92, 245, 275, 386
AlwI	GGATC	2 cut(s)	287, 349
AoxI	GGCC	1 cut(s)	478
ApeKI	GCWGC	1 cut(s)	224
ApoI	RAATTY	2 cut(s)	158, 264
AspS9I	GGNCC	3 cut(s)	26, 152, 478
AsuHPI	GGTGA	2 cut(s)	55, 275
AvaII	GGWCC	2 cut(s)	26, 152
BbvI	GCAGC	1 cut(s)	211
BccI	CCATC	1 cut(s)	143
BfaI	CTAG	1 cut(s)	347
BisI	GCNGC	1 cut(s)	225
BlsI	GCNGC	1 cut(s)	226
BmcAI	AGTACT	2 cut(s)	13, 132
Bme18I	GGWCC	2 cut(s)	26, 152
BmgT120I	GGNCC	3 cut(s)	26, 152, 478
BpuEI	CTTGAG	1 cut(s)	111
BsaJI	CCNNGG	1 cut(s)	170
Bsc4I	CCNNNNNNNGG	1 cut(s)	487
Bse1I	ACTGG	2 cut(s)	283, 361
BseDI	CCNNGG	1 cut(s)	170
BseGI	GGATG	1 cut(s)	46
BseLI	CCNNNNNNNGG	1 cut(s)	487
BseNI	ACTGG	2 cut(s)	283, 361
BseXI	GCAGC	1 cut(s)	211
BshFI	GGCC	1 cut(s)	480
BslI	CCNNNNNNNGG	1 cut(s)	487
BsmI	GAATGC	1 cut(s)	238
BsnI	GGCC	1 cut(s)	480
Bsp143I	GATC	4 cut(s)	51, 292, 319, 341
BspACI	CCGC	1 cut(s)	437
BspANI	GGCC	1 cut(s)	480
BspPI	GGATC	2 cut(s)	287, 349
BsrI	ACTGG	2 cut(s)	283, 361
BssECI	CCNNGG	1 cut(s)	170
BssMI	GATC	4 cut(s)	51, 292, 319, 341
BssT1I	CCWWGG	1 cut(s)	170
Bst4CI	ACNGT	2 cut(s)	70, 143
BstAPI	GCANNNNNTGC	1 cut(s)	233
BstC8I	GCNNGC	1 cut(s)	247
BstEII	GGTNACC	1 cut(s)	281
BstF5I	GGATG	1 cut(s)	46
BstKTI	GATC	4 cut(s)	54, 295, 322, 344
BstMBI	GATC	4 cut(s)	51, 292, 319, 341
BstMWI	GCNNNNNNNGC	3 cut(s)	121, 233, 242
BstPI	GGTNACC	1 cut(s)	281
BstV1I	GCAGC	1 cut(s)	211
BstX2I	RGATCY	1 cut(s)	341
BstXI	CCANNNNNNTGG	1 cut(s)	338
BstYI	RGATCY	1 cut(s)	341
BsuRI	GGCC	1 cut(s)	480
BtsCI	GGATG	1 cut(s)	46
Cac8I	GCNNGC	1 cut(s)	247
Cfr13I	GGNCC	3 cut(s)	26, 152, 478
Csp6I	GTAC	3 cut(s)	12, 131, 520
CviAII	CATG	3 cut(s)	254, 269, 527
CviJI	RGCY	7 cut(s)	92, 115, 245, 249, 275, 386, 480
CviKI_1	RGCY	7 cut(s)	92, 115, 245, 249, 275, 386, 480
CviQI	GTAC	3 cut(s)	12, 131, 520
DpnI	GATC	4 cut(s)	53, 294, 321, 343
DpnII	GATC	4 cut(s)	51, 292, 319, 341
Eco130I	CCWWGG	1 cut(s)	170
Eco47I	GGWCC	2 cut(s)	26, 152
Eco57I	CTGAAG	1 cut(s)	489
Eco91I	GGTNACC	1 cut(s)	281
EcoO65I	GGTNACC	1 cut(s)	281
EcoRI	GAATTC	1 cut(s)	158
EcoT14I	CCWWGG	1 cut(s)	170
ErhI	CCWWGG	1 cut(s)	170
FaeI	CATG	3 cut(s)	257, 272, 530
FatI	CATG	3 cut(s)	253, 268, 526
FauNDI	CATATG	1 cut(s)	187
Fnu4HI	GCNGC	1 cut(s)	225
FokI	GGATG	1 cut(s)	53
Fsp4HI	GCNGC	1 cut(s)	225
FspBI	CTAG	1 cut(s)	347
GluI	GCNGC	1 cut(s)	225
HaeIII	GGCC	1 cut(s)	480
Hin1II	CATG	3 cut(s)	257, 272, 530
HinfI	GANTC	5 cut(s)	5, 352, 449, 458, 514
HphI	GGTGA	2 cut(s)	55, 275
Hpy188I	TCNGA	1 cut(s)	303
Hpy188III	TCNNGA	3 cut(s)	155, 347, 371
HpyCH4III	ACNGT	2 cut(s)	70, 143
HpyCH4V	TGCA	3 cut(s)	20, 227, 236
HpyF10VI	GCNNNNNNNGC	3 cut(s)	121, 233, 242
Hsp92II	CATG	3 cut(s)	257, 272, 530
Kzo9I	GATC	4 cut(s)	51, 292, 319, 341
LmnI	GCTCC	3 cut(s)	97, 272, 401
LpnPI	CCDG	9 cut(s)	40, 168, 231, 264, 321, 356, 374, 438, 480
Lsp1109I	GCAGC	1 cut(s)	211
MaeI	CTAG	1 cut(s)	347
MaeIII	GTNAC	1 cut(s)	281
MalI	GATC	4 cut(s)	53, 294, 321, 343
MboI	GATC	4 cut(s)	51, 292, 319, 341
MboII	GAAGA	2 cut(s)	93, 420
MfeI	CAATTG	1 cut(s)	21
MflI	RGATCY	1 cut(s)	341
MluCI	AATT	7 cut(s)	21, 44, 158, 176, 201, 264, 417
MmeI	TCCRAC	1 cut(s)	394
MnlI	CCTC	2 cut(s)	31, 135
MseI	TTAA	2 cut(s)	179, 390
MunI	CAATTG	1 cut(s)	21
Mva1269I	GAATGC	1 cut(s)	238
MwoI	GCNNNNNNNGC	3 cut(s)	121, 233, 242
NdeI	CATATG	1 cut(s)	187
NdeII	GATC	4 cut(s)	51, 292, 319, 341
NlaIII	CATG	3 cut(s)	257, 272, 530
NmuCI	GTSAC	1 cut(s)	281
PctI	GAATGC	1 cut(s)	238
PfeI	GAWTC	5 cut(s)	5, 352, 449, 458, 514
PkrI	GCNGC	1 cut(s)	226
PspEI	GGTNACC	1 cut(s)	281
PspPI	GGNCC	3 cut(s)	26, 152, 478
PsuI	RGATCY	1 cut(s)	341
RsaI	GTAC	3 cut(s)	13, 132, 521
RsaNI	GTAC	3 cut(s)	12, 131, 520
SaqAI	TTAA	2 cut(s)	179, 390
SatI	GCNGC	1 cut(s)	225
Sau3AI	GATC	4 cut(s)	51, 292, 319, 341
Sau96I	GGNCC	3 cut(s)	26, 152, 478
ScaI	AGTACT	2 cut(s)	13, 132
SetI	ASST	5 cut(s)	94, 247, 277, 288, 388
SinI	GGWCC	2 cut(s)	26, 152
SmlI	CTYRAG	1 cut(s)	126
SmoI	CTYRAG	1 cut(s)	126
Sse9I	AATT	7 cut(s)	21, 44, 158, 176, 201, 264, 417
SsiI	CCGC	1 cut(s)	437
SspMI	CTAG	1 cut(s)	347
StyI	CCWWGG	1 cut(s)	170
TaaI	ACNGT	2 cut(s)	70, 143
TaqI	TCGA	2 cut(s)	240, 322
TasI	AATT	7 cut(s)	21, 44, 158, 176, 201, 264, 417
TatI	WGTACW	3 cut(s)	11, 130, 519
TfiI	GAWTC	5 cut(s)	5, 352, 449, 458, 514
Tru1I	TTAA	2 cut(s)	179, 390
Tru9I	TTAA	2 cut(s)	179, 390
TseFI	GTSAC	1 cut(s)	281
TseI	GCWGC	1 cut(s)	224
Tsp45I	GTSAC	1 cut(s)	281
TspDTI	ATGAA	6 cut(s)	57, 204, 242, 257, 408, 420
TspGWI	ACGGA	1 cut(s)	285
VpaK11BI	GGWCC	2 cut(s)	26, 152
XapI	RAATTY	2 cut(s)	158, 264
XbaI	TCTAGA	1 cut(s)	346
XspI	CTAG	1 cut(s)	347
ZrmI	AGTACT	2 cut(s)	13, 132

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.