Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003089.1

Orthogroup ID

OG0025552

Physical Location & Seq

Genomic Coordinates Forward (+)

89961 .. 90398

Gene Structure 438 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003089.1_g000020.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 342 bp

atgtctagtgtgacttgctgtttgaggttccctgggcaactcaactctgacctcagaaagttggctgtcaatctcattccattcccccgtctccactttttcattccattcctggtgggatgttttaatgcagaaaaagttgatatgcatgatcttcaggtgcggtatgctccacacatgccacttgtgttgcggggtctcacatgttccttccctggaggaatgaaaactgggattgtggggagaactggcagtggaaagtcaactctcatacaaactcttttccgaattttcgatcctgctgctggtatgttgctgatacttgtattcggaaagcagtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000325 GO:0003674 GO:0003824 GO:0005215 GO:0005575 GO:0005576 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005774 GO:0005911 GO:0006810 GO:0008150 GO:0009506 GO:0009605 GO:0009607 GO:0010290 GO:0015399 GO:0015405 GO:0015431 GO:0016020 GO:0016462 GO:0016787 GO:0016817 GO:0016818 GO:0016887 GO:0017111 GO:0022804 GO:0022857 GO:0030054 GO:0031090 GO:0042623 GO:0042626 GO:0043207 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043492 GO:0044422 GO:0044424 GO:0044437 GO:0044444 GO:0044446 GO:0044464 GO:0048046 GO:0050896 GO:0051179 GO:0051234 GO:0051704 GO:0051707 GO:0055044 GO:0055085 GO:0071997 GO:0098588 GO:0098805

KEGG Pathways

Metabolic & Signaling

ko01523 ko01524 ko02010 ko04976 map01523 map01524 map02010 map04976

Pfam Domains

Protein Families

ABC_membrane ABC_tran

Protein Analysis

113

Amino Acids

12.48

Weight (kDa)

9.84

Isoelectric Point (pI)

40.4

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025552)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_sc0003089.1_g000020 Rmu_sc0012557.1_g000005 Rmu_sc0024456.1_g000001

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	163, 193
AclWI	GGATC	1 cut(s)	290
AcsI	RAATTY	1 cut(s)	288
AcuI	CTGAAG	1 cut(s)	140
AfiI	CCNNNNNNNGG	1 cut(s)	305
AflIII	ACRYGT	1 cut(s)	203
AjnI	CCWGG	3 cut(s)	31, 111, 214
Alw26I	GTCTC	2 cut(s)	95, 203
AlwI	GGATC	1 cut(s)	290
ApeKI	GCWGC	1 cut(s)	302
ApoI	RAATTY	1 cut(s)	288
ArsI	GACNNNNNNTTYG	1 cut(s)	36
BbvI	GCAGC	1 cut(s)	289
BcgI	CGANNNNNNTGC	2 cut(s)	284, 318
BciT130I	CCWGG	3 cut(s)	33, 113, 216
BcoDI	GTCTC	2 cut(s)	95, 203
BfaI	CTAG	1 cut(s)	6
BisI	GCNGC	1 cut(s)	303
BlsI	GCNGC	1 cut(s)	304
Bme1390I	CCNGG	3 cut(s)	33, 113, 216
BmiI	GGNNCC	1 cut(s)	29
BmrFI	CCNGG	3 cut(s)	33, 113, 216
BmrI	ACTGGG	1 cut(s)	240
BmuI	ACTGGG	1 cut(s)	240
BpmI	CTGGAG	1 cut(s)	237
BsaI	GGTCTC	1 cut(s)	203
BsaJI	CCNNGG	3 cut(s)	31, 32, 214
Bsc4I	CCNNNNNNNGG	1 cut(s)	305
Bse1I	ACTGG	2 cut(s)	235, 253
BseBI	CCWGG	3 cut(s)	33, 113, 216
BseDI	CCNNGG	3 cut(s)	31, 32, 214
BseGI	GGATG	1 cut(s)	125
BseLI	CCNNNNNNNGG	1 cut(s)	305
BseMII	CTCAG	1 cut(s)	67
BseNI	ACTGG	2 cut(s)	235, 253
BseXI	GCAGC	1 cut(s)	289
BslI	CCNNNNNNNGG	1 cut(s)	305
BsmAI	GTCTC	2 cut(s)	95, 203
BsmBI	CGTCTC	1 cut(s)	95
Bso31I	GGTCTC	1 cut(s)	203
Bsp143I	GATC	2 cut(s)	151, 295
BspACI	CCGC	2 cut(s)	163, 193
BspCNI	CTCAG	1 cut(s)	66
BspLI	GGNNCC	1 cut(s)	29
BspPI	GGATC	1 cut(s)	290
BspTNI	GGTCTC	1 cut(s)	203
BsrI	ACTGG	2 cut(s)	235, 253
BssECI	CCNNGG	3 cut(s)	31, 32, 214
BssMI	GATC	2 cut(s)	151, 295
Bst2UI	CCWGG	3 cut(s)	33, 113, 216
BstDEI	CTNAG	1 cut(s)	53
BstF5I	GGATG	1 cut(s)	125
BstKTI	GATC	2 cut(s)	154, 298
BstMAI	GTCTC	2 cut(s)	95, 203
BstMBI	GATC	2 cut(s)	151, 295
BstNI	CCWGG	3 cut(s)	33, 113, 216
BstNSI	RCATGY	2 cut(s)	181, 207
BstSCI	CCNGG	3 cut(s)	31, 111, 214
BstV1I	GCAGC	1 cut(s)	289
BtsCI	GGATG	1 cut(s)	125
BtsI	GCAGTG	1 cut(s)	259
BtsIMutI	CAGTG	1 cut(s)	259
CspCI	CAANNNNNGTGG	2 cut(s)	171, 206
CviAII	CATG	3 cut(s)	149, 178, 204
CviJI	RGCY	1 cut(s)	65
CviKI_1	RGCY	1 cut(s)	65
DdeI	CTNAG	1 cut(s)	53
DpnI	GATC	2 cut(s)	153, 297
DpnII	GATC	2 cut(s)	151, 295
Eco31I	GGTCTC	1 cut(s)	203
Eco57I	CTGAAG	1 cut(s)	140
EcoRII	CCWGG	3 cut(s)	31, 111, 214
EcoT22I	ATGCAT	1 cut(s)	150
Esp3I	CGTCTC	1 cut(s)	95
FaeI	CATG	3 cut(s)	152, 181, 207
FaiI	YATR	7 cut(s)	146, 150, 168, 179, 205, 272, 311
FatI	CATG	3 cut(s)	148, 177, 203
FauI	CCCGC	1 cut(s)	186
Fnu4HI	GCNGC	1 cut(s)	303
FokI	GGATG	1 cut(s)	132
Fsp4HI	GCNGC	1 cut(s)	303
FspBI	CTAG	1 cut(s)	6
GluI	GCNGC	1 cut(s)	303
GsuI	CTGGAG	1 cut(s)	237
Hin1II	CATG	3 cut(s)	152, 181, 207
HincII	GTYRAC	1 cut(s)	264
HindII	GTYRAC	1 cut(s)	264
Hpy166II	GTNNAC	1 cut(s)	264
Hpy188I	TCNGA	4 cut(s)	49, 56, 287, 332
Hpy8I	GTNNAC	1 cut(s)	264
HpyAV	CCTTC	1 cut(s)	220
HpyCH4V	TGCA	2 cut(s)	131, 148
HpyF3I	CTNAG	1 cut(s)	53
Hsp92II	CATG	3 cut(s)	152, 181, 207
Kzo9I	GATC	2 cut(s)	151, 295
LmnI	GCTCC	1 cut(s)	175
Lsp1109I	GCAGC	1 cut(s)	289
MaeI	CTAG	1 cut(s)	6
MaeIII	GTNAC	1 cut(s)	10
MalI	GATC	2 cut(s)	153, 297
MboI	GATC	2 cut(s)	151, 295
MboII	GAAGA	1 cut(s)	146
MluCI	AATT	1 cut(s)	288
MnlI	CCTC	3 cut(s)	18, 62, 212
Mph1103I	ATGCAT	1 cut(s)	150
MseI	TTAA	1 cut(s)	126
MspR9I	CCNGG	3 cut(s)	33, 113, 216
MvaI	CCWGG	3 cut(s)	33, 113, 216
NdeII	GATC	2 cut(s)	151, 295
NlaIII	CATG	3 cut(s)	152, 181, 207
NlaIV	GGNNCC	1 cut(s)	29
NmuCI	GTSAC	1 cut(s)	10
NsiI	ATGCAT	1 cut(s)	150
NspI	RCATGY	2 cut(s)	181, 207
PasI	CCCWGGG	1 cut(s)	32
PciI	ACATGT	1 cut(s)	203
PkrI	GCNGC	1 cut(s)	304
PscI	ACATGT	1 cut(s)	203
Psp6I	CCWGG	3 cut(s)	31, 111, 214
PspGI	CCWGG	3 cut(s)	31, 111, 214
PspN4I	GGNNCC	1 cut(s)	29
SaqAI	TTAA	1 cut(s)	126
SatI	GCNGC	1 cut(s)	303
Sau3AI	GATC	2 cut(s)	151, 295
ScrFI	CCNGG	3 cut(s)	33, 113, 216
SetI	ASST	3 cut(s)	29, 54, 162
Sse9I	AATT	1 cut(s)	288
SsiI	CCGC	2 cut(s)	163, 193
SspMI	CTAG	1 cut(s)	6
StyD4I	CCNGG	3 cut(s)	31, 111, 214
TaqI	TCGA	1 cut(s)	294
TasI	AATT	1 cut(s)	288
Tru1I	TTAA	1 cut(s)	126
Tru9I	TTAA	1 cut(s)	126
TscAI	CASTG	1 cut(s)	259
TseFI	GTSAC	1 cut(s)	10
TseI	GCWGC	1 cut(s)	302
Tsp45I	GTSAC	1 cut(s)	10
TspDTI	ATGAA	2 cut(s)	91, 239
TspRI	CASTG	1 cut(s)	259
XapI	RAATTY	1 cut(s)	288
XceI	RCATGY	2 cut(s)	181, 207
XspI	CTAG	1 cut(s)	6
Zsp2I	ATGCAT	1 cut(s)	150

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.