Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0024456.1

Orthogroup ID

OG0025552

Physical Location & Seq

Genomic Coordinates Reverse (-)

987 .. 1349

Gene Structure 363 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0024456.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 363 bp

atgccacttgtgttgcggggtctcacatgttccttccctggaggaatgaaaactgggattgtggggagaactggcagtggaaagtcaactctcatacaaactcttttccgaattgtcgatcctgctgctggctggattttgatagatggcatcgatatctcttctattggattgcatgatctgaggtctaggctaagcattatccctcaggacccaaccatgtttgaaggaactgtaagaagcaatctggacccacttgaggagtatacagatgaacaaatttgggaggttagttcattttaccctgaggatgatacgaagcttctttttaaatattgttcattgtcagatttgcagctctaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000325 GO:0003674 GO:0003824 GO:0005215 GO:0005575 GO:0005576 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005774 GO:0005911 GO:0006810 GO:0008150 GO:0009506 GO:0009605 GO:0009607 GO:0010290 GO:0015399 GO:0015405 GO:0015431 GO:0016020 GO:0016462 GO:0016787 GO:0016817 GO:0016818 GO:0016887 GO:0017111 GO:0022804 GO:0022857 GO:0030054 GO:0031090 GO:0042623 GO:0042626 GO:0043207 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043492 GO:0044422 GO:0044424 GO:0044437 GO:0044444 GO:0044446 GO:0044464 GO:0048046 GO:0050896 GO:0051179 GO:0051234 GO:0051704 GO:0051707 GO:0055044 GO:0055085 GO:0071997 GO:0098588 GO:0098805

KEGG Pathways

Metabolic & Signaling

ko01523 ko01524 ko02010 ko04976 map01523 map01524 map02010 map04976

Pfam Domains

Protein Families

ABC_membrane ABC_tran

Protein Analysis

120

Amino Acids

13.31

Weight (kDa)

4.56

Isoelectric Point (pI)

40.36

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025552)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_sc0003089.1_g000020 Rmu_sc0012557.1_g000005 Rmu_sc0024456.1_g000001

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	266
AciI	CCGC	1 cut(s)	16
AclWI	GGATC	1 cut(s)	113
AcsI	RAATTY	1 cut(s)	279
AfiI	CCNNNNNNNGG	2 cut(s)	128, 259
AflIII	ACRYGT	1 cut(s)	26
AgsI	TTSAA	1 cut(s)	227
AjnI	CCWGG	1 cut(s)	37
AluBI	AGCT	2 cut(s)	322, 358
AluI	AGCT	2 cut(s)	322, 358
Alw26I	GTCTC	1 cut(s)	26
AlwI	GGATC	1 cut(s)	113
ApeKI	GCWGC	2 cut(s)	125, 355
ApoI	RAATTY	1 cut(s)	279
AspS9I	GGNCC	2 cut(s)	211, 250
AvaII	GGWCC	2 cut(s)	211, 250
AxyI	CCTNAGG	2 cut(s)	207, 306
BbvI	GCAGC	1 cut(s)	112
BccI	CCATC	1 cut(s)	140
BcgI	CGANNNNNNTGC	2 cut(s)	107, 141
BciT130I	CCWGG	1 cut(s)	39
BcoDI	GTCTC	1 cut(s)	26
BfaI	CTAG	1 cut(s)	189
BisI	GCNGC	2 cut(s)	126, 356
BlpI	GCTNAGC	1 cut(s)	194
BlsI	GCNGC	2 cut(s)	127, 357
Bme1390I	CCNGG	1 cut(s)	39
Bme18I	GGWCC	2 cut(s)	211, 250
BmgT120I	GGNCC	2 cut(s)	211, 250
BmiI	GGNNCC	2 cut(s)	213, 252
BmrFI	CCNGG	1 cut(s)	39
BmrI	ACTGGG	1 cut(s)	63
BmsI	GCATC	1 cut(s)	159
BmuI	ACTGGG	1 cut(s)	63
BpmI	CTGGAG	1 cut(s)	60
Bpu1102I	GCTNAGC	1 cut(s)	194
BpuEI	CTTGAG	1 cut(s)	278
Bsa29I	ATCGAT	1 cut(s)	153
BsaI	GGTCTC	1 cut(s)	26
BsaJI	CCNNGG	1 cut(s)	37
Bsc4I	CCNNNNNNNGG	2 cut(s)	128, 259
Bse1I	ACTGG	2 cut(s)	58, 76
Bse21I	CCTNAGG	2 cut(s)	207, 306
BseBI	CCWGG	1 cut(s)	39
BseCI	ATCGAT	1 cut(s)	153
BseDI	CCNNGG	1 cut(s)	37
BseGI	GGATG	1 cut(s)	316
BseLI	CCNNNNNNNGG	2 cut(s)	128, 259
BseMII	CTCAG	3 cut(s)	173, 221, 297
BseNI	ACTGG	2 cut(s)	58, 76
BseRI	GAGGAG	1 cut(s)	275
BseXI	GCAGC	1 cut(s)	112
BshVI	ATCGAT	1 cut(s)	153
BslI	CCNNNNNNNGG	2 cut(s)	128, 259
BsmAI	GTCTC	1 cut(s)	26
Bso31I	GGTCTC	1 cut(s)	26
Bsp143I	GATC	2 cut(s)	118, 178
Bsp1720I	GCTNAGC	1 cut(s)	194
BspACI	CCGC	1 cut(s)	16
BspCNI	CTCAG	3 cut(s)	174, 220, 298
BspDI	ATCGAT	1 cut(s)	153
BspLI	GGNNCC	2 cut(s)	213, 252
BspPI	GGATC	1 cut(s)	113
BspTNI	GGTCTC	1 cut(s)	26
BsrI	ACTGG	2 cut(s)	58, 76
BssECI	CCNNGG	1 cut(s)	37
BssMI	GATC	2 cut(s)	118, 178
BssNAI	GTATAC	1 cut(s)	267
Bst1107I	GTATAC	1 cut(s)	267
Bst2UI	CCWGG	1 cut(s)	39
Bst4CI	ACNGT	1 cut(s)	235
Bst6I	CTCTTC	1 cut(s)	166
BstC8I	GCNNGC	1 cut(s)	130
BstDEI	CTNAG	4 cut(s)	182, 194, 207, 306
BstF5I	GGATG	1 cut(s)	316
BstKTI	GATC	2 cut(s)	121, 181
BstMAI	GTCTC	1 cut(s)	26
BstMBI	GATC	2 cut(s)	118, 178
BstNI	CCWGG	1 cut(s)	39
BstNSI	RCATGY	1 cut(s)	30
BstSCI	CCNGG	1 cut(s)	37
BstV1I	GCAGC	1 cut(s)	112
BstZ17I	GTATAC	1 cut(s)	267
Bsu15I	ATCGAT	1 cut(s)	153
Bsu36I	CCTNAGG	2 cut(s)	207, 306
BsuTUI	ATCGAT	1 cut(s)	153
BtsCI	GGATG	1 cut(s)	316
BtsI	GCAGTG	1 cut(s)	82
BtsIMutI	CAGTG	1 cut(s)	82
Cac8I	GCNNGC	1 cut(s)	130
Cfr13I	GGNCC	2 cut(s)	211, 250
ClaI	ATCGAT	1 cut(s)	153
CspCI	CAANNNNNGTGG	1 cut(s)	29
CviAII	CATG	3 cut(s)	27, 176, 220
CviJI	RGCY	4 cut(s)	132, 193, 322, 358
CviKI_1	RGCY	4 cut(s)	132, 193, 322, 358
DdeI	CTNAG	4 cut(s)	182, 194, 207, 306
DpnI	GATC	2 cut(s)	120, 180
DpnII	GATC	2 cut(s)	118, 178
DraI	TTTAAA	1 cut(s)	331
Eam1104I	CTCTTC	1 cut(s)	166
EarI	CTCTTC	1 cut(s)	166
Eco31I	GGTCTC	1 cut(s)	26
Eco32I	GATATC	1 cut(s)	157
Eco47I	GGWCC	2 cut(s)	211, 250
Eco81I	CCTNAGG	2 cut(s)	207, 306
EcoO109I	RGGNCCY	1 cut(s)	211
EcoRII	CCWGG	1 cut(s)	37
EcoRV	GATATC	1 cut(s)	157
FaeI	CATG	3 cut(s)	30, 179, 223
FaiI	YATR	5 cut(s)	28, 95, 177, 221, 267
FatI	CATG	3 cut(s)	26, 175, 219
FauI	CCCGC	1 cut(s)	9
FblI	GTMKAC	1 cut(s)	266
Fnu4HI	GCNGC	2 cut(s)	126, 356
FokI	GGATG	1 cut(s)	323
Fsp4HI	GCNGC	2 cut(s)	126, 356
FspBI	CTAG	1 cut(s)	189
GluI	GCNGC	2 cut(s)	126, 356
GsuI	CTGGAG	1 cut(s)	60
Hin1II	CATG	3 cut(s)	30, 179, 223
HincII	GTYRAC	1 cut(s)	87
HindII	GTYRAC	1 cut(s)	87
HindIII	AAGCTT	1 cut(s)	320
Hpy166II	GTNNAC	2 cut(s)	87, 267
Hpy188I	TCNGA	3 cut(s)	110, 183, 349
Hpy188III	TCNNGA	2 cut(s)	209, 248
Hpy8I	GTNNAC	2 cut(s)	87, 267
HpyAV	CCTTC	2 cut(s)	43, 221
HpyCH4III	ACNGT	1 cut(s)	235
HpyCH4V	TGCA	2 cut(s)	175, 355
HpyF3I	CTNAG	4 cut(s)	182, 194, 207, 306
Hsp92II	CATG	3 cut(s)	30, 179, 223
Kzo9I	GATC	2 cut(s)	118, 178
Lsp1109I	GCAGC	1 cut(s)	112
LweI	GCATC	1 cut(s)	159
MaeI	CTAG	1 cut(s)	189
MalI	GATC	2 cut(s)	120, 180
MboI	GATC	2 cut(s)	118, 178
MboII	GAAGA	1 cut(s)	153
MluCI	AATT	2 cut(s)	111, 279
MnlI	CCTC	6 cut(s)	35, 177, 216, 253, 280, 301
MseI	TTAA	1 cut(s)	330
MspR9I	CCNGG	1 cut(s)	39
MvaI	CCWGG	1 cut(s)	39
NdeII	GATC	2 cut(s)	118, 178
NlaIII	CATG	3 cut(s)	30, 179, 223
NlaIV	GGNNCC	2 cut(s)	213, 252
NspI	RCATGY	1 cut(s)	30
PciI	ACATGT	1 cut(s)	26
PkrI	GCNGC	2 cut(s)	127, 357
PpuMI	RGGWCCY	1 cut(s)	211
PscI	ACATGT	1 cut(s)	26
Psp5II	RGGWCCY	1 cut(s)	211
Psp6I	CCWGG	1 cut(s)	37
PspGI	CCWGG	1 cut(s)	37
PspN4I	GGNNCC	2 cut(s)	213, 252
PspPI	GGNCC	2 cut(s)	211, 250
PspPPI	RGGWCCY	1 cut(s)	211
SaqAI	TTAA	1 cut(s)	330
SatI	GCNGC	2 cut(s)	126, 356
Sau3AI	GATC	2 cut(s)	118, 178
Sau96I	GGNCC	2 cut(s)	211, 250
ScrFI	CCNGG	1 cut(s)	39
SetI	ASST	4 cut(s)	188, 291, 324, 360
SfaNI	GCATC	1 cut(s)	159
SinI	GGWCC	2 cut(s)	211, 250
SmlI	CTYRAG	1 cut(s)	257
SmoI	CTYRAG	1 cut(s)	257
Sse9I	AATT	2 cut(s)	111, 279
SsiI	CCGC	1 cut(s)	16
SspI	AATATT	1 cut(s)	335
SspMI	CTAG	1 cut(s)	189
StyD4I	CCNGG	1 cut(s)	37
TaaI	ACNGT	1 cut(s)	235
TaqI	TCGA	2 cut(s)	117, 153
TasI	AATT	2 cut(s)	111, 279
Tru1I	TTAA	1 cut(s)	330
Tru9I	TTAA	1 cut(s)	330
TscAI	CASTG	1 cut(s)	82
TseI	GCWGC	2 cut(s)	125, 355
TspDTI	ATGAA	4 cut(s)	62, 285, 288, 330
TspRI	CASTG	1 cut(s)	82
VpaK11BI	GGWCC	2 cut(s)	211, 250
XapI	RAATTY	1 cut(s)	279
XceI	RCATGY	1 cut(s)	30
XmiI	GTMKAC	1 cut(s)	266
XspI	CTAG	1 cut(s)	189

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.