Rmu_sc0003354.1_g000003

Pentatricopeptide repeat-containing protein At5g50390

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003354.1
Physical Location & Seq
Forward (+)
11428 .. 11921
494 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003354.1_g000003.1.cds

Sequence Viewer

Length: 381 bp
atgtcgacgaagacaattgtaggatggaatacgatcatagtgggttatgcacttcatggttacagcgaggaggctttgagtatggactatgatatgtgtgattctggtgtgccgatggaccattttactttttccatgaccataagaacctgtgcaaggatagaagatgctcgtcatgtttttgatcagatgcctaacaacatcatatcttggaatgccttgattgttggatatggtaaccgtggttggggtgatgaggctgttgagatgtttgagaagatgcttcaggaaggaatgatacccaaccatgttacatttcttgttgtctttgtctgcttgccgttgttcaggtttatcagaacgtggatgggagatttttga

Protein Analysis

126

Amino Acids

14.5

Weight (kDa)

4.83

Isoelectric Point (pI)

43.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024806)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0167811
rosa_multiflora Rmu_sc0003354.1_g000003
rosa_samantha Rh2AG601100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 5
AcuI CTGAAG 1 cut(s) 269
AfiI CCNNNNNNNGG 2 cut(s) 156, 247
AspS9I GGNCC 1 cut(s) 118
AsuHPI GGTGA 1 cut(s) 263
AvaII GGWCC 1 cut(s) 118
BarI GAAGNNNNNNTAC 2 cut(s) 282, 314
BbsI GAAGAC 1 cut(s) 17
BccI CCATC 3 cut(s) 18, 109, 361
BceAI ACGGC 1 cut(s) 325
BclI TGATCA 1 cut(s) 184
Bme18I GGWCC 1 cut(s) 118
BmgT120I GGNCC 1 cut(s) 118
BmsI GCATC 3 cut(s) 157, 180, 270
BpiI GAAGAC 1 cut(s) 17
BsaJI CCNNGG 1 cut(s) 241
Bsc4I CCNNNNNNNGG 2 cut(s) 156, 247
BseDI CCNNGG 1 cut(s) 241
BseGI GGATG 2 cut(s) 29, 372
BseLI CCNNNNNNNGG 2 cut(s) 156, 247
BseRI GAGGAG 1 cut(s) 83
BslI CCNNNNNNNGG 2 cut(s) 156, 247
BsmI GAATGC 1 cut(s) 220
Bsp143I GATC 2 cut(s) 33, 184
BssECI CCNNGG 1 cut(s) 241
BssMI GATC 2 cut(s) 33, 184
Bst4CI ACNGT 1 cut(s) 242
BstC8I GCNNGC 1 cut(s) 338
BstDSI CCRYGG 1 cut(s) 241
BstEII GGTNACC 1 cut(s) 236
BstENI CCTNNNNNAGG 1 cut(s) 154
BstF5I GGATG 2 cut(s) 29, 372
BstKTI GATC 2 cut(s) 36, 187
BstMBI GATC 2 cut(s) 33, 184
BstPI GGTNACC 1 cut(s) 236
BstV2I GAAGAC 1 cut(s) 17
BtgI CCRYGG 1 cut(s) 241
BtsCI GGATG 2 cut(s) 29, 372
Cac8I GCNNGC 1 cut(s) 338
Cfr13I GGNCC 1 cut(s) 118
CviAII CATG 4 cut(s) 56, 136, 176, 308
CviJI RGCY 2 cut(s) 74, 260
CviKI_1 RGCY 2 cut(s) 74, 260
DpnI GATC 2 cut(s) 35, 186
DpnII GATC 2 cut(s) 33, 184
Eco47I GGWCC 1 cut(s) 118
Eco57I CTGAAG 1 cut(s) 269
Eco91I GGTNACC 1 cut(s) 236
EcoNI CCTNNNNNAGG 1 cut(s) 154
EcoO65I GGTNACC 1 cut(s) 236
FaeI CATG 4 cut(s) 59, 139, 179, 311
FatI CATG 4 cut(s) 55, 135, 175, 307
FbaI TGATCA 1 cut(s) 184
FblI GTMKAC 1 cut(s) 5
FokI GGATG 1 cut(s) 36
Hin1II CATG 4 cut(s) 59, 139, 179, 311
HincII GTYRAC 1 cut(s) 6
HindII GTYRAC 1 cut(s) 6
HinfI GANTC 1 cut(s) 101
HphI GGTGA 1 cut(s) 263
Hpy166II GTNNAC 1 cut(s) 6
Hpy188I TCNGA 2 cut(s) 189, 359
Hpy188III TCNNGA 1 cut(s) 287
Hpy8I GTNNAC 1 cut(s) 6
Hpy99I CGWCG 1 cut(s) 10
HpyAV CCTTC 1 cut(s) 284
HpyCH4III ACNGT 1 cut(s) 242
HpyCH4IV ACGT 1 cut(s) 362
HpyCH4V TGCA 2 cut(s) 50, 155
HpySE526I ACGT 1 cut(s) 362
Hsp92II CATG 4 cut(s) 59, 139, 179, 311
Ksp22I TGATCA 1 cut(s) 184
Kzo9I GATC 2 cut(s) 33, 184
LpnPI CCDG 4 cut(s) 90, 163, 272, 334
LweI GCATC 3 cut(s) 157, 180, 270
MaeII ACGT 1 cut(s) 362
MaeIII GTNAC 3 cut(s) 59, 236, 310
MalI GATC 2 cut(s) 35, 186
MboI GATC 2 cut(s) 33, 184
MboII GAAGA 3 cut(s) 22, 176, 289
MfeI CAATTG 1 cut(s) 15
MluCI AATT 1 cut(s) 15
MmeI TCCRAC 1 cut(s) 208
MnlI CCTC 3 cut(s) 61, 64, 250
MunI CAATTG 1 cut(s) 15
Mva1269I GAATGC 1 cut(s) 220
NdeII GATC 2 cut(s) 33, 184
NlaIII CATG 4 cut(s) 59, 139, 179, 311
PctI GAATGC 1 cut(s) 220
PfeI GAWTC 1 cut(s) 101
PspEI GGTNACC 1 cut(s) 236
PspPI GGNCC 1 cut(s) 118
SalI GTCGAC 1 cut(s) 4
Sau3AI GATC 2 cut(s) 33, 184
Sau96I GGNCC 1 cut(s) 118
SetI ASST 3 cut(s) 152, 353, 365
SfaNI GCATC 3 cut(s) 157, 180, 270
SinI GGWCC 1 cut(s) 118
Sse9I AATT 1 cut(s) 15
TaaI ACNGT 1 cut(s) 242
TaiI ACGT 1 cut(s) 365
TaqI TCGA 1 cut(s) 5
TasI AATT 1 cut(s) 15
TfiI GAWTC 1 cut(s) 101
TspDTI ATGAA 1 cut(s) 44
VpaK11BI GGWCC 1 cut(s) 118
XagI CCTNNNNNAGG 1 cut(s) 154
XmiI GTMKAC 1 cut(s) 5
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.